Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Question: A double stranded DNA molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long.
TACATGATCATTTCACGGAATTTCTAGCATGTAATGTACTAGTAAAGTGCCTTAAAGATCGTACAT
a. Which strand of DNA is transcribed and in which direction?b. Label the 5' and the 3' ends of each strand.c. In an inversion occurs between the second and the third triplets from the left and right ends, respectively, and the same strand of DNA is transcribed, how long will the resultant polypeptide be?
In modern blimps, the gas of choice used to inflate them is helium rather than hydrogen. Hydrogen would be lighter, but helium is safer. Discuss similarities and differences of the atomic structure of hydrogen and helium.
In forensic analysis using STR systems, up to 16 different loci can be tested in a single PCR reaction. Why is it important for forensic analysis that each locus being tested is present on a different chromosome? Ideas are justified.
Consider the HIV enzyme called protease. The amino acid residues at the active site are highly hydrophobic. In designing a drug that would bind to the active site and jam it, researchers should use which sort of molecule.
Twenty g soil sample was added to 80 ml of water to make the final volume of 100 ml (tube A). Then, ten ml of the ‘tube A' solution was taken and added to 90 ml of water.
A train is travelling up a 3.73 degree incline at a speed of 3.25m/s as the last car breaks free. How far does last car travel before its speed momentarily reaches zero.
Once you arrive at the distal ileum, go through mucosal membrane and enter the bloodstream via the Superior Mesenteric Vein. Evaluate the cellular organelles and other structures to the parts of a city. For instance, the nucleus is city hall and the ..
What is the most common agent of UTIs . The pool regularly becomes infested with disease-causing viruses and bacteria. Which species are more possible to thrive in the changing environment.
The mitochondria a of mutant yeast strain is discovered to oxidize NADH even in the absensce of ADP. How would the P/O ratio of this mutant compare to the wilfe type?
What advantage will heterozygotes have over the homozygotes. Why selection inevitably favors any gene that is good at getting into the next generation, regardless of whether that gene helps or hurts the ecosystem, the species, the group, or even the ..
The phosphate system serves to buffer intracellular fluid of cells at physiological pH because pK2 (7.20) lies near the normal pH range of 6.9-7.4. If the total cellular concentration of phosphate is 19mM and the pH is 6.9, what is the concentrati..
The expression and purification of rGFP started with the increase of the bacterial culture and ended with elution of rGFP off the Ni+2 agarose coloumn.
List and express at least three prokaryotic cellular features that might be targeted in this way to inhibit or kill a bacterial pathogen.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd