Design two primers that will amplify the largest

Assignment Help Biology
Reference no: EM132118989

What to do - Given the following piece of double stranded DNA (the two strands below bind together to form a piece of double stranded DNA) design two primers that will amplify the largest piece of DNA possible. 

  • While primers are usually ~20 nucleotides long, please make yours 9 nucleotides long for simplicity.
  • The size of your PCR product is roughly the distance between your two primers. See at the bottom of this question for a hint on how to calculate it. 
  • Remember direction is important! You should indicate on your primer sequence which is the 3' end and which is the 5' end.

5' - AATGTACCGCGTCTAGGCTGCTGATGCTTAGTCCCCCGATGATCGTGTGAAAAAGTAATCGTGCTGA

3' - TTACATGGCGCAGATCCGACGACTACGAATCAGGGGGCTACTAGCACACTTTTTCATTAGCACGACT

Hint: you need to find primers that amplify the largest piece of DNA possible. You can work out the length of your DNA fragment like this.

Highlight where your primers would bind on the DNA strands. In this example I have designed primers that would bind where the sequence is underlined. 

5' - XXXXXXXXXXXXXXXXXXXXX

3' - XXXXXXXXXXXXXXXXXXXXX

I'm going to replace the underlines with P (for primer) just so you can keep track of where it is.

5' - PPPPXXXXXXXXXXXXXXXXX

3' - XXXXXXXXXXXXXXPPPPXXX

Now if I've designed my primers correctly and amplify this sequence then I should get a fragment that looks like this 

5' - PPPPXXXXXXXXXXXXXX

3' - XXXXXXXXXXXXXXPPPP

Notice only the area under the primer and between the two primers is replicated. Your job is to find the largest fragment you can replicate.

Reference no: EM132118989

Questions Cloud

Set up a wireless network by using packet tracer simulation : Wireless Networking Assignment - Set up a wireless network by using Packet Tracer simulation software. Does every laptop ping every other laptop
Description of our relationship with bacteroides : Briefly explain why commensalism is not an adequate description of our relationship with Bacteroides thetaiotaomicron.
Marrying of cousins was a common thing among : Marrying of cousins was a common thing among the royals. Please expalin genetically why this is this no
Levels of dissolved oxygen in the gulf waters : What factors (physical and biological) can affect the levels of dissolved oxygen in the Gulf waters? Think of the oxygen cycle.
Design two primers that will amplify the largest : While primers are usually ~20 nucleotides long, please make yours 9 nucleotides long for simplicity.
Prepare a professional report on TOC : Prepare a Professional REPORT on TOC - MINIMUM 10 suitable high-quality peer-reviewed scholarly journal articles
Types of proteins that regulate sugar catabolism : List three different types of proteins that regulate sugar catabolism and explain how they work together to provide a coordinated
Describe two extensions to the original garch model : Describe two extensions to the original GARCH model. What additional characteristics of financial data might they be able to capture
Privacy issues that arise in the cyberspace field : An overview of Googles cloud computing services and their security - Privacy issues that arise in the cyberspace field - An investigation on Facebook privacy

Reviews

Write a Review

Biology Questions & Answers

  How many times must the diameter of the flagellum

A typical bacterial flagellum is about 20 nm wide. About how many times must the diameter of the flagellum be increased to make visible using a bright field microscope?

  Could mitosis or meiosis occur in prokaryotes

Colchicine is a chemical that prevents the formation of microtubules. What would be the effect of adding colchicine to cells just before mitosis were to begin.

  Compute the isoelectric point of a protein

compute the isoelectric point of a protein. It would also be helpful if you could declare any constants (i.e. pH=5) in advance of both problems.

  Describe five steps in chromosome replication

List and describe five steps in chromosome replication at the replication fork. The steps must be in order.

  Feature of cholesterol-characteristic of the lipaseenzymes

A person with a disorder that limits absorption of bile isat increased risk for deficiency of: which of the following stimulates the pancreas to releasebicarbonate-rich juice? which of the following is characteristic of the lipaseenzymes. which of th..

  Generation time of these bacteria

What is the generation time of these bacteria under these conditions?

  Which cranial nerve is probably being compressed

A tumor is pressing on one cranial nerve. The most significant presenting sign is unequal pupils. Which cranial nerve is probably being compressed?

  Find the maximum number of genotypes in progeny

In mountain rabbits, the EL-1 gene is located on chromosome three. 7-alleles of this gene have been identified in the population. With respect to EL-1,

  Imagine that the study had revealed

Intuition tells us that small samples lead to fluke results. Let's double thesample size and imagine that the study had revealed 14 errors in one year

  What are some of the discrimination and prejudice

French Canadians have had a difficult time assimlating into Canadian culture and as part of the national identity. What are some of the issues relating to assimilation for Francophones in Canada?

  A sample of potassium nitrate (49g) is dissolved

A sample of potassium nitrate (49g) is dissolved in 101g of water at 100 degrees C, with precautions taken to avoid evaporation of any water. The solution is cooled to 30.0 degrees C and a small amount of precipitate is observed. This solution is ___..

  Explain the molecular clock hypothesis

Explain the molecular clock hypothesis and its utility in paleoanthropology. In your explanation be sure to discuss several examples of molecular clock dating.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd