Design two primers that will amplify the largest

Assignment Help Biology
Reference no: EM132118989

What to do - Given the following piece of double stranded DNA (the two strands below bind together to form a piece of double stranded DNA) design two primers that will amplify the largest piece of DNA possible. 

  • While primers are usually ~20 nucleotides long, please make yours 9 nucleotides long for simplicity.
  • The size of your PCR product is roughly the distance between your two primers. See at the bottom of this question for a hint on how to calculate it. 
  • Remember direction is important! You should indicate on your primer sequence which is the 3' end and which is the 5' end.

5' - AATGTACCGCGTCTAGGCTGCTGATGCTTAGTCCCCCGATGATCGTGTGAAAAAGTAATCGTGCTGA

3' - TTACATGGCGCAGATCCGACGACTACGAATCAGGGGGCTACTAGCACACTTTTTCATTAGCACGACT

Hint: you need to find primers that amplify the largest piece of DNA possible. You can work out the length of your DNA fragment like this.

Highlight where your primers would bind on the DNA strands. In this example I have designed primers that would bind where the sequence is underlined. 

5' - XXXXXXXXXXXXXXXXXXXXX

3' - XXXXXXXXXXXXXXXXXXXXX

I'm going to replace the underlines with P (for primer) just so you can keep track of where it is.

5' - PPPPXXXXXXXXXXXXXXXXX

3' - XXXXXXXXXXXXXXPPPPXXX

Now if I've designed my primers correctly and amplify this sequence then I should get a fragment that looks like this 

5' - PPPPXXXXXXXXXXXXXX

3' - XXXXXXXXXXXXXXPPPP

Notice only the area under the primer and between the two primers is replicated. Your job is to find the largest fragment you can replicate.

Reference no: EM132118989

Questions Cloud

Set up a wireless network by using packet tracer simulation : Wireless Networking Assignment - Set up a wireless network by using Packet Tracer simulation software. Does every laptop ping every other laptop
Description of our relationship with bacteroides : Briefly explain why commensalism is not an adequate description of our relationship with Bacteroides thetaiotaomicron.
Marrying of cousins was a common thing among : Marrying of cousins was a common thing among the royals. Please expalin genetically why this is this no
Levels of dissolved oxygen in the gulf waters : What factors (physical and biological) can affect the levels of dissolved oxygen in the Gulf waters? Think of the oxygen cycle.
Design two primers that will amplify the largest : While primers are usually ~20 nucleotides long, please make yours 9 nucleotides long for simplicity.
Prepare a professional report on TOC : Prepare a Professional REPORT on TOC - MINIMUM 10 suitable high-quality peer-reviewed scholarly journal articles
Types of proteins that regulate sugar catabolism : List three different types of proteins that regulate sugar catabolism and explain how they work together to provide a coordinated
Describe two extensions to the original garch model : Describe two extensions to the original GARCH model. What additional characteristics of financial data might they be able to capture
Privacy issues that arise in the cyberspace field : An overview of Googles cloud computing services and their security - Privacy issues that arise in the cyberspace field - An investigation on Facebook privacy

Reviews

Write a Review

 

Biology Questions & Answers

  Immune response to infectious disease

It is a very curcial concept to understand how the immune response is mounted against viruses, bacteria, protozoans and helminthes. For an effective immune response, both innate and adaptive immunity should work together.

  A review on advanced glycated end products (ages)

This Project report elaborates a critical review of important elements attached to Advanced Glycated End Products (AGEs). It is very crucial to understand the process called Millard reaction.

  Plastic as a soil stabilizer

Soil stabilization is the permanent physical and chemical alteration of soils to enhance their physical properties. Stabilization can increase the shear strength of a soil and control the shrink-swell properties.

  Principles of microbiology

This assignment has three parts which contains questions related to Microbiology. It contains basic principles of microscopy, staining techniques in microbiology and microbial growth in the food industry.

  List the biologic functions

Lipid metabolites are often seen as key elements in cellular signaling. Is this unique? Please provide several examples of the function of lipids as key elements in signal arrays and list the biologic functions these signals affect?

  Biologic function relationships

Please describe how one might search for chemical structure, biologic function relationships, involving small molecular weight lipophylic compounds. Provide one example.

  Case study on patient in the haematology laboratory

Write a case study which detailing a scenario of a patient being investigated in the Haematology laboratory.

  Use of pcr and genetic approaches in biotechnology

The use of PCR and genetic approaches in biotechnology

  Describe the role of this enzyme in honey

Glucose oxidase is an enzyme that can be used for measurements of glucose levels by combining this reaction with an oxygen probe.

  Genetic problems

What phenotypic ratio would you get if you crossed a white mouse and a heterozygous brown mouse?

  Prepare an essay on nosocomial infection

Prepare an essay on nosocomial infection.

  Monitoring and recording the blood pressure

To increase the awareness of monitoring and recording the blood pressure of patients and practice measuring blood pressure in a safe environment.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd