Compute the observed distance

Reference no: EM1385664

DNA Region of 50 nucleotides has been sequenced in two different species.

Species 1 AATGCTGTGCCGAGCTAGCTAGTATGTTGCTAGCTAGATCGATCGACTGA

Species 2 GTAGCTATGCTGTGCTTGCTAGCATCTTTCTGGCTATATAGATTGATCCC

Calculate the observed Distance D at the molcular level betwee these tow sequeces, the correcteddistance by using jukes and cantors method jc and the corrected distance by using kimuras 2 parameter k2 method.If the same 2 sequences of 50 nucleoties shown are now with an addition of a third sequence species 3.

Species 1 AATGCTGTGCCGAGCTAGCTAGTATGTTGCTAGCTAGATCGATCGACTGA

Species 2 GTAGCTATGCTGTGCTTGCTAGCATCTTTCTGGCTATATAGATTGATCCC

Species 3 GTAGCTTTGCTGTGCTTGCTTGCATCTATCTGGGTATATAGTTTGATCCC

Compute the observed distance d at the molecular level between the three sequences and the corrected distance by using kimuras 2 parameter k2 method

drae two phylogenic trees depicting the relationships among these three using D and other tree using K2.

Reference no: EM1385664

Questions Cloud

Articles on the concept of ethical relativism : Research several articles on the concept of Ethical Relativism and write down paper which comprehensively explains both the basic concept and its cultural implications.

Interested in understanding what the supermarkets image : A local supermarkets management is interested in understanding what the supermarkets image is in a particular market. Cashiers drop a short questionnaire into the grocery bag of each customer who makes a purchase.

Determine the probability for each event : If a six appears for the third time, the turn of the player ends without moving the token. Determine the sample space of one such throw and determine the probability for each event.

Aligning personal and professional code of ethics : Why is the reaction to a personal code of ethics from fellow employees important to the individual and to the organization? How are issues resolved in aligning a personal code of ethics with the ethics of an organization?

Compute the observed distance : Compute the observed distance d at the molecular level between the three sequences and the corrected distance by using kimuras 2 parameter k2 method

Linear correlation between the number of cigarettes : Describe the error in the conclusion. Given: There is a linear correlation between the number of cigarettes smoked and the pulse rate. As the number of cigarettes increases the pulse rate increases. Conclusion: Cigarettes cause the pulse rate to i..

Javascript function to verify fields if cookie is added : JavaScript function has verified that all the required fields have been filled, cookie is added to user's computer. If same user tries to fill out form second time.

Exploiting a resource to ruination : Determine what is it called when individual benefit is maximized by exploiting a resource to ruination?

Probability that the student will pass the test : The probability that student pilot passes the written test for a private pilot's license is 0.7. Find the probability that the student will pass the test: (a) on the third attempt (b) before the fourth attempt.

User Account

All Pages