Calculate the odds ratio for each allele

Assignment Help Other Subject

Reference no: EM131464929

Topic: Bioinformatics Case Control study using Perl

Considering the following sample results of a case-control study for a disease, write a Perl script named calcAlleleOdds.pl that study each position (assuming all positions are SNP positions) reporting the allele with the maximum odds ratio. Although Chi-square test is a usual test model for association studies, but we will skip it in this assignment.

You need to calculate the odds ratio for each allele, and then report the allele with the maximum odds ratio). Calculating odds ratio is provided in the Supplement slides and was discussed in the lecture/recording of Wed class.

You may face a known problem in calculating odds ratio, i.e. when the cells of the 2x2 table (that is used to calculate odds ratios) contain one or more of zero values, the solution for this problem is provided in the Supplement slides too.

In case, an allele with an odds ratio > 1.5 is found for a position, report that this position is associated with the disease.

You may copy-paste the data to a local text file so that you may read the data using the Perl script.

You will need to submit the Perl script that you made for the assignment. The output of the Perl script should be a tab-separated file named alleles.tsv that provides the following information:

Position (1-based index)	Allele	Odds ratio	Associated (Yes or No)

Cases:

TACGCAGTCGACAGGTATAGCCTACATGTACTCGACATGTACTCGGT
TACGCCGTCGACATGTATAGTCTACATGTACTCGACATGTACTCGGT
TACGCAGTCGACAGGTATAGTCTACATGTACTCGACATGTACTCGGT
TACGCAGTCGACAGGTATAGCCTACATGTACTCAACATGTACTCGGT
TACGCCGTCGACATGTATAGCCTACATGTACTCGACATGTACTCGGT
TACGCCGTCGACATGTATAGCCTACATGTACTCGACATGTACTCGGT
TACGCCGTCGACAGGTATAGCCTACATGTACTCGACATGTACTCGGT
TACGCAGTCGACAGGTATAGCCTACATGTACTCGACATGTACTCTGT

Controls:

TAGGCAGTCGATAGGTATAACCTACATGTCCTCGACAGGTACTCGGT
TAGGCGGTCGATATGTATAATCTACATGTCCTCGACAGGTACTCGGT
TAGGCAGTCGATAGGTATAATCTACATGTCCTCGACAGGTACTCGGT
TAGGCAGTCGATAGGTATAACCTACATGTCCTCAACAGGTACTCGGT
TAGGCGGTCGATATGTATAACCTACATGTCCTCGACAGGTACTCGGT
TAGGCGGTCGATATGTATAACCTACATGTCCTCGACAGGTACTCGCT
TACGCGGTCGATAGGTATAACCTACATGTCCTCGACAGGTACTCGCA
TACGCAGTCGACAGGTATAACCTACATGTACTCGACATGTACTCTCA

Reference no: EM131464929

Questions Cloud

Technology applications around healthcare : Name 4 vendors who present similar technology applications around healthcare

Define efficiency of labour : a. Define Efficiency of Labour b. List and explain five factors that affect efficiency of labour

How frequently does company forecast-annual budget cycle : How frequently does your company forecast? Is there an annual budget cycle?

Analysis of the international economy : Develop a minimum 1,050-word analysis of the international economy in which you do the following:

Calculate the odds ratio for each allele : write a Perl script named calcAlleleOdds.pl that study each position reporting the allele with the maximum odds ratio. You need to calculate the odds ratio

How would you describe ray sozzis leadership style : Student Advantage LLC, based in Boston, provides college students at over a thousand U.S. campuses with credit cards that give them discounts in shops.

Discuss why you would would request that form of payment : Discuss why you would would request that form of payment,

Prices tend to favor the keynesian economic : Why does the flexibility of wages and prices tend to favor the Keynesian economic view in the short run but favor the classical economic view in the long run?

Calculate the capacity of each machine center : Analyze where the focus of the company's efforts should be if Beck wants to expand capacity.

User Account

All Pages