Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Question: Determine what biological function do methylases perform in bacteria? What adaptive value do they have for a bacterium?
4. The following DNA is part of a gene that codes for a polypeptide of at least seven amino acids:
3' caattgattagtcagtcaatt gat 5'
5' gttaactaatcagtcagttaa cta 3'
a. Which strand includes an Open Reading Frame? Top (T) or Bottom (B)
b. Is this protein generated from the 1st, 2nd or 3rd frame?
c. Give the complimentary mRNA sequence that would be transcribed from this gene; label the 5' & 3' ends.
d) Give the seven amino acids that would be translated from the correct message; label the C & N ends.
Degrade a monoglyceride that has an 18-carbon fatty acid attached to it by Ester bonds. You will have to degrade the glycerol component followed by the fatty acid in presence of O2.
A women is perspiring profusely with rapid breathing, breath smells like acetone and blood sugar is 650mg/ml, blood chemistry indicates acidosis, what is her diagnosis, is it hypoglicemia, but thrown off by rapid breathing.
The bacteria are allowed to grow overnight and are streaked on a plate using the technique that produces isolated colonies that are clones of the original. Samples of these colonies are then grown in four different media: nutrient broth plus ampicill..
What is an inspiratory capacity (IC) of a person with a tidal volume of 505 ml and an inspiratory reserve volume of 1950 ml? Is this person male or female.
What is the phenotypic ratio you would expect to see in the F2 generation if you were following a sex-linked trait? An autosomal trait? Two autosomal dominant characters (dihybrid cross).
In mid afternoon, they are on it's under surface, each caterpillar hanging by a few legs. Offer a hypothesis to explain this behaviour. How would you test it.
A bowl of potato salad was left on picnic table for three hours on hot summer day. The microbial load was 300 CFU/g when the salad was put on table.
Assume you treated butter with a fatty acid desaturase, an enzyme that removes hydrogen from fatty acids and creates double bonds.
Both endocrine and nervous systems are major regulating systems of the body; though, nervous system has been compared to an airmail delivery system and endocrine system to the pony express. In brief explain this comparison.
The seeds of orchids are among the smallest known, with virtually no endosperm and with miniscule seed leaves. As a result, what must one expect to be true of such seeds.
Assume you have a protein solution of concentration 3 M. You require to make a series of six dilutions of 300 mM, 30 mM, 3 mM, 300 mu M, 30 mu M, and 3 mu M.
Those that live in tropical climates like the savannas of Africa are usually much smaller than the ones that live in arctic regions like Lapland.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd