Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Why is ridge mapping required and what is its alternative
The selection of the implant diameter apart from the mesiodistal space available also depends on the buccolingual width of the alveolar bone available. We need to have at least 0.5 to 1 mm covering on both the buccal and lingual aspect of the implants.
Conventional radiography gives only a 2 dimensional image and it is impossible to judge the width with conventional x rays (IOPA, OPG). Also clinically due to the soft tissue thickness which varies from patient to patient and from area to area in the same patient, it is again very difficult to assess the width of available bone at the implant site. Ridge mapping allows for this measurement although it is a time consuming process. The CT scan with multiplanar reformatted images (dentascan) allows paraxial cross sections which can alternatively be used to measure bone width.
How do plants take in oxygen? First cells in take carbon dioxide and does photosynthesis, which take water, sugar, and CO2 and then makes oxygen and a green pigment. Though,
Q.Explain about Stress Testing in Women? Data on mortality in men is about 2.5 times that of women. At younger ages, however, CAD in men exceeds that found in women by 5 to 1.
What is the lymphatic system? The lymphatic system is a network of specialized valved vessels that drain interstitial fluid (lymph). The lymphatic system is also responsible fo
Lauric Fats Fats of this group are derived from certain species of palm, such as coconut. The fats are characterized by their high content of lauric acid (40 - 50%), moderate
What are some examples of human cells that produce proteins for exportation? Which cytoplasmic organelle is expected to be well-developed and abundant in those cells? Specializ
How is it produced and what is the function of cholecystokin in the digestive process? The fat level of the chyme detect in the duodenum stimulates the secretion of cholecystok
Define reagent required and methodology for Barfoed Test? Reagents - Solutions of glucose, fructose, galactose, lactose, maltose, sucrose and starch - Barfoed's reagent
Mylohyoid muscle Surgical manipulation at the crest of a severely resorbed ridge may injure the mylohyoid muscle. Manipulation of the tissues of the floor of the mouth for plac
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What are fossil fuels? Fossil fuels, like oil, gas and coal, form when organic material is preserved from the complete action of decomposers, generally buried deep and under pr
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd