respiration, Biology

#question about fish
Posted Date: 11/18/2012 4:38:59 AM | Location : USA







Related Discussions:- respiration, Assignment Help, Ask Question on respiration, Get Answer, Expert's Help, respiration Discussions

Write discussion on respiration
Your posts are moderated
Related Questions
1. DNA damaga can be spontaneous or can be 'Induced by external agents a. What are 'spontaneous' mutations? Give examples of causes of spontaneous mutations and the kinds od DNA

A dihybrid cross: Determines the genetic makeup of an organism always involves homozygous alleles. Always involves organisms that are heterozygous at all loci. Always involves alle

using examples of invertebrate phyla illustrate how the increase in complexity is reflected by their nervous system?

Q. Concerning solubility, how are the lipids classified? Oils and Fats are hydrophobic molecules, i.e., they are insoluble in water and non polar. Lipids in general are molecul

Q. What is hypercholeslerolaemia? Cholesterol: It is a natural component of foods such as mutton, pork, ham, sausages, lamb, chicken, eggs (yellow), whole milk, cheese, ice-cre

Minerals :- Aluminium                Food Source       Low and variable in foods, component of some antacids and leavening agents Nutritional Functional role Possib

Explain the Manifestations of Iron Deficiency Anaemia? • Paleness of conjunctiva • Paleness of tongue • Paleness of mucosa of soft palate • Low haemoglobin • Swelling of

Explain what an isotope is and explain one use of isotopes.

The sound levels of power, intensity and pressure are the physical effects which the human ear receives, it is not, however, what the person perceives. What is being perceived or h

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT