Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Oxygen Dissociation Curves
The oxygen content of blood fully saturated or oxygenated can be calculated. It is known as the oxygen capacity of blood and this varies for different species. In humans the oxygen carrying capacity is 20 ml oxygen per 100 ml blood. The relationship of oxygen carrying capacity to surrounding oxygen concentration can be shown graphically by oxygen dissociation curves.
Figure: Oxygen dissociation curve shows how haemoglobin's oxygen binding capacity depends on partial pressure of oxygen.
These curves are obtained by subjecting blood samples to different partial pressures of oxygen. The per cent oxyhaemoglobin saturation at different partial pressures of oxygen is plotted. The oxygen dissociation curve is S-Shaped or a sigmoid curve. From the graph we can see how haemoglobin acts as a carrier of oxygen. Total saturation occurs in the lungs where arterial pressure is above 95 mm Hg and the oxygen is unloaded at low Po2 found in tissues (about 40 mm Hg).
what is cromosome jumping
What are special properties of transparency factors in corneal hydration of cornea? The factors affecting the transparency include special properties of the corneal epitheliu
How Vaginal infections cause Sulfonamide creams, other ''broad-spectrum'' vaginal preparations, and currently available preparations of Lactobacillus species or dairy products
Why is genetic homozygosity dangerous to a nearly extinct species? Genetic homozygosity leaves no variation for natural selection to act on. Thus, a new disease could wipe
Subphylum Opalinata Body covered with longitudinal rows of cilium like ,organelles but true ciliature absent. Parasitic; cytosome lacking; two to many nuclei of one type.
Domestication - Wildlife It means that man has taken under his direct care the living beings which are useful to him. Through extensive breeding programmes, he has modified th
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What er the Parafunctional Habits Parafunctional Habits like bruxism and clenching create mechanical and biological problems due to overloading and are considered to be one of
trinominal names
What are the types of leukocytes and how are they classified into granulocytes and agranulocytes? The types of leukocytes are monocytes, lymphocytes, neutrophils, eosinophils
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd