Oxygen dissociation curves, Biology

Assignment Help:

Oxygen Dissociation Curves

The oxygen content of blood fully saturated or oxygenated can be calculated. It is known as the oxygen capacity of blood and this varies for different species. In humans the oxygen carrying capacity is 20 ml oxygen per 100 ml blood. The relationship of oxygen carrying capacity to surrounding oxygen concentration can be shown graphically by oxygen dissociation curves.

1504_Oxygen Dissociation Curves.png

Figure:  Oxygen dissociation curve shows how haemoglobin's oxygen binding capacity depends on partial pressure of oxygen.

These curves are obtained by subjecting blood samples to different partial pressures of oxygen. The per cent oxyhaemoglobin saturation at different partial pressures of oxygen is plotted. The oxygen dissociation curve is S-Shaped or a sigmoid curve. From the graph we can see how haemoglobin acts as a carrier of oxygen. Total saturation occurs in the lungs where arterial pressure is above 95 mm Hg and the oxygen is unloaded at low Po2 found in tissues (about 40 mm Hg).


Related Discussions:- Oxygen dissociation curves

Properties of transparency factors in corneal hydration, What are special p...

What are special properties of transparency factors in corneal hydration of cornea? The factors affecting the transparency include special properties of the corneal epitheliu

How vaginal infections cause, How Vaginal infections cause Sulfonamide ...

How Vaginal infections cause Sulfonamide creams, other ''broad-spectrum'' vaginal preparations, and currently available preparations of Lactobacillus  species or dairy products

Why is genetic homozygosity dangerous, Why is genetic homozygosity dangerou...

Why is genetic homozygosity dangerous to a nearly extinct species? Genetic homozygosity leaves no variation for natural selection to act on. Thus, a new disease could wipe

Subphylum opalinata, Subphylum Opalinata Body covered with longitudin...

Subphylum Opalinata Body covered with longitudinal rows of cilium like ,organelles but true ciliature absent. Parasitic; cytosome lacking; two to many nuclei of one type.

Domestication - wildlife, Domestication - Wildlife It means that man h...

Domestication - Wildlife It means that man has taken under his direct care the living beings which are useful to him. Through extensive breeding programmes, he has modified th

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What er the parafunctional habits, What er the Parafunctional Habits P...

What er the Parafunctional Habits Parafunctional Habits like bruxism and clenching create mechanical and biological problems due to overloading and are considered to be one of

What are the types of leukocytes, What are the types of leukocytes and how ...

What are the types of leukocytes and how are they classified into granulocytes and agranulocytes? The types of leukocytes are monocytes, lymphocytes, neutrophils, eosinophils

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd