N-terminal cysteine amino acid , Biology

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. 

ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATTCTTTATCCG

  M  S  L  P  Q  S  R  W  V  A  C F  S  I  E  G  I  L  Y  P

This gene encodes an enzyme in which the N-terminal cysteine amino acid is thought to be the active site of the enzyme. You have been asked to change this amino acid into a tryptophan to assess what effect this may have on its in vitro enzyme activity.

Design a site-directed mutagenesis experiment to perform this amino acid alteration; including showing the nucleotide sequences of the primers that would be required to make such a change. Design the primers to result in maximum efficiency of PCR product formation, which entails not only generating PCR product from the parental template, but also DNA that has been newly synthesised from the PCR reaction itself.

 

Posted Date: 3/11/2013 1:35:39 AM | Location : United States







Related Discussions:- N-terminal cysteine amino acid , Assignment Help, Ask Question on N-terminal cysteine amino acid , Get Answer, Expert's Help, N-terminal cysteine amino acid Discussions

Write discussion on N-terminal cysteine amino acid
Your posts are moderated
Related Questions
Q. What are some human diseases caused by virus and what are their respective modes of transmission? The major viral diseases transmitted by respiratory secretions (cough, snee

Pharmacognosy :  This is the study of medicinal plants. Pharmacognosy is a kind of the study of medicines which are derived from natural sources. The American Society of Pharmacogn

Explain Viruses and their classification? Viruses are living organisms. Viruses are not living organisms. No, the above is not a misprint! In fact, viruses defy the normal c

what is plasmodium

Define Drug effects on Vitamin and mineral metabolism? Vitamin and mineral metabolism: Micronutrients are required as cofactors or coenzymes in many metabolic pathways, includi

Describe the filaments in the muscle fiber A healthy skeletal muscle fiber is isolated and has no external forces on it. It has normal intracellular levels of ATP and is bathed

Membrane proteins are classify as either integral (intrinsic) or peripheral (extrinsic) depending on how tightly they are linked with membrane. The Integral membrane proteins are s

Pathophysiology   The exact mechanism of glomerulonephritis  is still under investigation. The dies'ease is characterised by deposition  of immune complexes  consisting of anti

Define Reagents required and Methodology for Fehling's Test? - Sugar solutions of glucose, fructose, galactose, lactose, maltose, sucrose, starch - Fehling A (Copper sulphat

Explain Ledge bypass - Non-surgical Endodontic Retreatment   Ledge bypass - StSt not NiT cause it has shape memory Ledges from outside the curvatures. The file t