N-terminal cysteine amino acid , Biology

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. 

ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATTCTTTATCCG

  M  S  L  P  Q  S  R  W  V  A  C F  S  I  E  G  I  L  Y  P

This gene encodes an enzyme in which the N-terminal cysteine amino acid is thought to be the active site of the enzyme. You have been asked to change this amino acid into a tryptophan to assess what effect this may have on its in vitro enzyme activity.

Design a site-directed mutagenesis experiment to perform this amino acid alteration; including showing the nucleotide sequences of the primers that would be required to make such a change. Design the primers to result in maximum efficiency of PCR product formation, which entails not only generating PCR product from the parental template, but also DNA that has been newly synthesised from the PCR reaction itself.

 

Posted Date: 3/11/2013 1:35:39 AM | Location : United States







Related Discussions:- N-terminal cysteine amino acid , Assignment Help, Ask Question on N-terminal cysteine amino acid , Get Answer, Expert's Help, N-terminal cysteine amino acid Discussions

Write discussion on N-terminal cysteine amino acid
Your posts are moderated
Related Questions
Explain how a human eye is working for the body. Every tissue in the body requires basic components which are either derived from the body itself or we acquire them from extern

Which organs are protected by (a) the skull, (b) the rib cage, (c) the vertebrae?   a) The skull safe the brain, b) the rib cage safes the heart, lungs, liver and spleen,


COMMON DISEASE OF CAMELS - 1 .       SURRA - Surra = Rotten. Spread by biting & blood sucking flies, dropping neck, half closed eyes are common symptoms. 2 .

Determine the Human Energy Requirements? This unit focuses on the human energy requirements. The nutrient requirement for Indian population, you may recall studying in the last

SKI N GRAFTING - Skin for grafting is taken from another part of body of the same persons. Now it is possible to grow a sheet of skin in culture from a small piece of skin

Posterior Maxilla Posterior maxilla has very poor quality of bone demanding special consideration in implant placement:  Increasing the number of implants to decrease the cr

In continuous wave Doppler, the transducer has two Doppler crystals, one to constantly transmit and one to continuously receive. As a result of this continuous mode of tra


entamoeba histolyca and Giardia lambia were isolated