N-terminal cysteine amino acid , Biology

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. 

ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATTCTTTATCCG

  M  S  L  P  Q  S  R  W  V  A  C F  S  I  E  G  I  L  Y  P

This gene encodes an enzyme in which the N-terminal cysteine amino acid is thought to be the active site of the enzyme. You have been asked to change this amino acid into a tryptophan to assess what effect this may have on its in vitro enzyme activity.

Design a site-directed mutagenesis experiment to perform this amino acid alteration; including showing the nucleotide sequences of the primers that would be required to make such a change. Design the primers to result in maximum efficiency of PCR product formation, which entails not only generating PCR product from the parental template, but also DNA that has been newly synthesised from the PCR reaction itself.

 

Posted Date: 3/11/2013 1:35:39 AM | Location : United States







Related Discussions:- N-terminal cysteine amino acid , Assignment Help, Ask Question on N-terminal cysteine amino acid , Get Answer, Expert's Help, N-terminal cysteine amino acid Discussions

Write discussion on N-terminal cysteine amino acid
Your posts are moderated
Related Questions
Special type of Wards: Additional  accommodation or differences  in size and shape of some of  the special type of wards e.g. Intensive Care Ward, Infectious diseases ward and

The environmental pollution has become a biggest threat  to humanity. To over-come this problem a suitable preventive legislation is need of hour. The problems of acid rain ,ozone

summarise the comparative anatomy of the digestive system of the invertebrate and the vertebrate.

Q. What are alkalosis and acidosis? Acidosis is the condition in which the blood pH is abnormally low Alkalosis is the condition in which the blood pH is abnormally high Normal

Tricuspid Stenosis :  Acquired tricuspid stenosis is most often due to chronic rheumatic carditis. Rarely could it be due to right atrial tumors or carcinoid syndrome producing mi

Q. What do you mean by biodigester? A biodigester is equipment that produces hydrogen sulfide, carbon dioxide and fuel gases (biogases) like methane from organic material under

Explain Coarctation of Aorta ? Coarctation of aorta may be isolated or it may have other co-existing cardiac and vascular lesions. In critically ill neonates with coarctation,

NSP NSP or dietary fibre is the name given to a group of materials found in the cell walls of plants which gives the plant its structure and form. Food hydrocolloids Fo

Explain about Folic acid Folic acid occurs as a yellow or orange-yellow, microcrystalline powder, almost without odour and taste. Water content of folic acid is up to 8.5%. Fol

Role of cell death As development of the limb proceeds waves of death or necrosis of large masses of mesodermal cells occur in certain regions at different stages. This has be