N-terminal cysteine amino acid , Biology

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. 

ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATTCTTTATCCG

  M  S  L  P  Q  S  R  W  V  A  C F  S  I  E  G  I  L  Y  P

This gene encodes an enzyme in which the N-terminal cysteine amino acid is thought to be the active site of the enzyme. You have been asked to change this amino acid into a tryptophan to assess what effect this may have on its in vitro enzyme activity.

Design a site-directed mutagenesis experiment to perform this amino acid alteration; including showing the nucleotide sequences of the primers that would be required to make such a change. Design the primers to result in maximum efficiency of PCR product formation, which entails not only generating PCR product from the parental template, but also DNA that has been newly synthesised from the PCR reaction itself.

 

Posted Date: 3/11/2013 1:35:39 AM | Location : United States







Related Discussions:- N-terminal cysteine amino acid , Assignment Help, Ask Question on N-terminal cysteine amino acid , Get Answer, Expert's Help, N-terminal cysteine amino acid Discussions

Write discussion on N-terminal cysteine amino acid
Your posts are moderated
Related Questions
In the living condition (found in sea) you would be able to observe the following features in radiolarians: The cytoplasm is divided by a perforated and chitinous metnbrane into

VARI A TION S - Defined as "dissimilarities of features among members of the same species". Offsprings of same parent are different and also differ from their parent.

STRUCTUR E OF SPERMATOZOAN Structure of sperm is divided into 3 parts -      (1) Head                  (2) Middle piece             (3) Tail 1 .       HEAD

Explain Need For Microbiological Analysis of Environment Samples? Once the food is harvested, it passes through various operating steps before reaching the consumer. These step

Biota of Pelagic Zone Pelagic region constitutes 90 per cent of the total ocean surface and is less rich in species and numbers of organisms than the two regions discussed bef

What characteristics might a breeder select for in (i) a cereal crop, (ii) a farm animal? (i) In a cereal variety, a breeder might select for high yield; disease-, frost- or dr

How to calculate the raw score for each scale The raw score for each scale is the sum of the 0, 1 and 2 item scores. Thus, the higher the score, the poorer the performance. Th

Zearalenone It was first isolated as the agent responsible for vulvovaginitis in pigs has very little acute toxicity, but there should be some concern about chronic exposure t

Explain Objectives of Root-End Resection Apicoectomy a) Removal of untreated apical portion of the root, b) Enable the obturator to determine the cause of failure,  c) To

Role of citrate Citrate in addition to being an  intermediate  of citric acid cycle provides a source of acetyl CoA for  the cytosolic synthesis of fatty acids. Citrate inhi