N-terminal cysteine amino acid , Biology

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. 

ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATTCTTTATCCG

  M  S  L  P  Q  S  R  W  V  A  C F  S  I  E  G  I  L  Y  P

This gene encodes an enzyme in which the N-terminal cysteine amino acid is thought to be the active site of the enzyme. You have been asked to change this amino acid into a tryptophan to assess what effect this may have on its in vitro enzyme activity.

Design a site-directed mutagenesis experiment to perform this amino acid alteration; including showing the nucleotide sequences of the primers that would be required to make such a change. Design the primers to result in maximum efficiency of PCR product formation, which entails not only generating PCR product from the parental template, but also DNA that has been newly synthesised from the PCR reaction itself.

 

Posted Date: 3/11/2013 1:35:39 AM | Location : United States







Related Discussions:- N-terminal cysteine amino acid , Assignment Help, Ask Question on N-terminal cysteine amino acid , Get Answer, Expert's Help, N-terminal cysteine amino acid Discussions

Write discussion on N-terminal cysteine amino acid
Your posts are moderated
Related Questions
MONOSACCHARIDES Simple carbohydrate monomers, which cannot be hydrolysed further into simpler or smaller subunits. Monosaccharides are generally colourless, crystallin

The intermediates in the cycle give precursors for various biosynthetic pathways. An instance is as given below: -  From citrate synthesis of fatty acids; -  Amino acid synth

Q. Why is colour an important characteristic of food? Colour is an important quality attribute in food although they do not necessarily influence their nutritional, flavour or

#question.3 different genera of invertebrates

Studying a single rock Select a single rock and try to learn as more as possible about it from careful observation. If it is flat, it is probably a piece or layer from Sediment

Q. Symptoms of hiatus hernia? In most patients, no symptoms are seen. When symptoms do occur, they are: 1. discomfort after heavy meal, 2. Difficulty in breathing while l

Biology is becoming a more quantitative science, a trend that has motivated and been recently spurred by advances in computing power and data-gathering technologies. Nowhere is th

Theodosius Dobzhansky and Boris Spassky demonstrated the working of normalising selectioion a behavioural trait in two populations of Drosophida pseudobscura. The two populatiors w

Advantages of vegetative propagation Vegetative propagation helps to maintain fixed qualities and characteristic features of the parent plant. For Example in ornamental p

Q. How different are animal cells from plant cells? While plant cells are eukaryotic, photosynthetic, autotrophic and have chloroplasts and cell wall, the animal cells are hete