N-terminal cysteine amino acid , Biology

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. 

ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATTCTTTATCCG

  M  S  L  P  Q  S  R  W  V  A  C F  S  I  E  G  I  L  Y  P

This gene encodes an enzyme in which the N-terminal cysteine amino acid is thought to be the active site of the enzyme. You have been asked to change this amino acid into a tryptophan to assess what effect this may have on its in vitro enzyme activity.

Design a site-directed mutagenesis experiment to perform this amino acid alteration; including showing the nucleotide sequences of the primers that would be required to make such a change. Design the primers to result in maximum efficiency of PCR product formation, which entails not only generating PCR product from the parental template, but also DNA that has been newly synthesised from the PCR reaction itself.

 

Posted Date: 3/11/2013 1:35:39 AM | Location : United States







Related Discussions:- N-terminal cysteine amino acid , Assignment Help, Ask Question on N-terminal cysteine amino acid , Get Answer, Expert's Help, N-terminal cysteine amino acid Discussions

Write discussion on N-terminal cysteine amino acid
Your posts are moderated
Related Questions
Define Objective of Taxonomy - Assemblage of Knowledge Gained? A second objective of taxonomy is the assemblage of knowledge gained. This is usually in the form of treatises us

That is eutrophication? Explain with reference to aquatic ecosystem. or Name any two source organisms of agar. List any four areas in which agar has wide application.

Self- vs. Cross-Pollination A major advantage of self-pollination is its certainty. Continued self-pollination over many generations, however, results in weaker progeny. This

Q. Explain nutritional management of metabolic diseases? The nutritional management of metabolic diseases such as gout and a few inborn errors of metabolism such as phenylketon

Nutrient Absorption Except for carbon, oxygen and hydrogen which are provided by CO 2 and water, all the other elements essential for plants are provided by the soil. Hence,

It consists of: - Two kidneys that produce urine. - The left and right ureters that the urine travels through on leaving the kidneys. - The muscular urinary bladder, which

Explain Antimicrobial Prophylaxis Antimicrobial prophylaxis can decrease the incidence of infection, particularly surgical site infection, after certain operations, but this be

What is Single S 2 In cyanotic TOF, S, consists entirely of A, as P, is attenuated by a deformed pulmonary valve when there is valvar steuosis and aorta is placed anteriorly re

Equipment :  Basically, it has an intra aortic balloon pump. A balloon with a capacity of 40 ml is passed percutaneously through the femoral artery up to the upper end of descen

Test for Venous Function Make patient stand, apply a tourniquet at mid-thigh firmly enough to occlude the superficial veins, but not the deep veins or the arteries.