N-terminal cysteine amino acid , Biology

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. 

ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATTCTTTATCCG

  M  S  L  P  Q  S  R  W  V  A  C F  S  I  E  G  I  L  Y  P

This gene encodes an enzyme in which the N-terminal cysteine amino acid is thought to be the active site of the enzyme. You have been asked to change this amino acid into a tryptophan to assess what effect this may have on its in vitro enzyme activity.

Design a site-directed mutagenesis experiment to perform this amino acid alteration; including showing the nucleotide sequences of the primers that would be required to make such a change. Design the primers to result in maximum efficiency of PCR product formation, which entails not only generating PCR product from the parental template, but also DNA that has been newly synthesised from the PCR reaction itself.

 

Posted Date: 3/11/2013 1:35:39 AM | Location : United States







Related Discussions:- N-terminal cysteine amino acid , Assignment Help, Ask Question on N-terminal cysteine amino acid , Get Answer, Expert's Help, N-terminal cysteine amino acid Discussions

Write discussion on N-terminal cysteine amino acid
Your posts are moderated
Related Questions
Explain Adverse effects of Atazanavir  Atazanavir causes indirect hyperbilirubinemia. It has had no adverse effects on lipid profiles, but the drug's long-term effects are unkn

Explain vegetable sterilization process Canning, which involves heat sterilization, is one of the most important processes in vegetable preservation. As compared to other foods

Subphylum Crustacea Crustacea are mainly aquatic arthropods with gills for respiration. Cephalothorax has usually a carapace; appendages biramous but modified for several fun

What is an operon, and in what type of organism are operons found? An operon is a series of genes that code for exact products and the regulatory elements that control those ge

Explain the factors that led to the decline of Science in Europe during iron age

Q. Explain about Lactose Intolerance? We commonly hear from people of all age groups, particularly children and elderly to be complaining of abdominal discomfort after consumin

What processes occur during the budding of yeast?

BACK CROSS When F 1  individual (Tt) is crossed with one of the two parents, either tall (TT) or dwarf (tt), such a cross is called the back cross. There are two possibilities

Milkers’ nodules Milkers’ nodules are caused either by cowpox virus, an orthopoxvirus or pseudocowpox virus, a parapoxvirus. These are relatively benign lesions that occur most co

Timing and number of doses It has been common practice to give antibiotics at the time of anesthesia induction, which results in adequate serum and tissue levels of the drugs;