N-terminal cysteine amino acid , Biology

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. 

ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATTCTTTATCCG

  M  S  L  P  Q  S  R  W  V  A  C F  S  I  E  G  I  L  Y  P

This gene encodes an enzyme in which the N-terminal cysteine amino acid is thought to be the active site of the enzyme. You have been asked to change this amino acid into a tryptophan to assess what effect this may have on its in vitro enzyme activity.

Design a site-directed mutagenesis experiment to perform this amino acid alteration; including showing the nucleotide sequences of the primers that would be required to make such a change. Design the primers to result in maximum efficiency of PCR product formation, which entails not only generating PCR product from the parental template, but also DNA that has been newly synthesised from the PCR reaction itself.

 

Posted Date: 3/11/2013 1:35:39 AM | Location : United States







Related Discussions:- N-terminal cysteine amino acid , Assignment Help, Ask Question on N-terminal cysteine amino acid , Get Answer, Expert's Help, N-terminal cysteine amino acid Discussions

Write discussion on N-terminal cysteine amino acid
Your posts are moderated
Related Questions
The vascular tone increases as the arterial size decreases. The tone at any time reflects the effects of excitory and inhibitory pathways. Neurotransmitters, physical forces like s

Explain the OBJECTIVES of history of mart disease? After reading this unit, you should be able to: 1. Understand the importance of Cardio-vascular diseases as the leading cause

Calf diptheria The disease is a serious one usually affecting calves up to 2 years of age. The lesions are confined to larynx and pharynx, and consist of well-defined areas of nec

MIDDL E EAR - Protected by tympanic bone. It's cavity is tympanic cavity. It is lined by simple cilliated columnar epithelium. It is connected to naso pharynx by Eu


Define the Quantitative Analysis in Nutritional Biochemistry? Quantitative analysis involves the measurement of the amount of a substance present. This measurement can be done

Define the effect of niacin deficiency on Nervous System? Delirium is the most common -mental disturbance in acute pellagra. Dementia is more frequently seen in the chronic cas

Endodermis is the layer of cells surrounding the vascular cylinder of plants.

Which of the following serves as an actuating signal, or as part of an actuating signal, in a negative feedback system? A. Blood plasma levels of Glucose. B. Blood plasma le

Role of Biotic Factors Inducing Senescence Besides environmental and endogenous factors, biotic factors also play a role in inducing senescence. For example, due to an attack