N-terminal cysteine amino acid , Biology

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. 

ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATTCTTTATCCG

  M  S  L  P  Q  S  R  W  V  A  C F  S  I  E  G  I  L  Y  P

This gene encodes an enzyme in which the N-terminal cysteine amino acid is thought to be the active site of the enzyme. You have been asked to change this amino acid into a tryptophan to assess what effect this may have on its in vitro enzyme activity.

Design a site-directed mutagenesis experiment to perform this amino acid alteration; including showing the nucleotide sequences of the primers that would be required to make such a change. Design the primers to result in maximum efficiency of PCR product formation, which entails not only generating PCR product from the parental template, but also DNA that has been newly synthesised from the PCR reaction itself.

 

Posted Date: 3/11/2013 1:35:39 AM | Location : United States







Related Discussions:- N-terminal cysteine amino acid , Assignment Help, Ask Question on N-terminal cysteine amino acid , Get Answer, Expert's Help, N-terminal cysteine amino acid Discussions

Write discussion on N-terminal cysteine amino acid
Your posts are moderated
Related Questions
How does the structure of a chloroplast enable it to build up a concentration gradient of protons?  Chloroplasts have an inner membrane system having of thylakoids. The pumpin

What is the relationship between the estrogen level and the LH level in the menstrual cycle? What is the function of LH in the menstrual cycle and when does its blood concentration

Birds and Mammals - Heart is 4 chambered. 2 auricles & 2 ventricles. Sinus venosus & truncus arteriosus absent. Arteriovenous heart. Double circulation i.e. pre

The non-oxidative phase  generates  ribose precursors The non-oxidative phase of  the pathway,  including the following reactions, converts pentose-5-phosphate to other sugars.

Interferons are small glycoproteins formed by virus-infected cells that inhibit viral infection. They are heterogeneous. Gamma interferons induce MHC class II antigens in macrophag

Which of the two forms of respiration (aerobic and anaerobic) gives more energy from a given quantity of food? Aerobic respiration gives more energy than anaerobic respiration

What are the risk factors of cataractogenesis? Risk Factors of Cataractogenesis: a. Hereditary b. Exposure to ultra violet radiation: The ultra violet radiation of 290

What is Physical activity ratio? Physical activity ratio (PAR): The energy cost of an activity per unit of time (usually a minute or an hour) expressed as a multiple of BMR. It

Q. Etiological factors involved in short bowel syndrome? The etiological factors involved in this disease are: • Anaemia • Osteoporosis • Stone formation • Decrease

Explain about the Bulimia Nervosa? Bulimia Nervosa, as you may recall studying earlier, is a disorder characterized by episodes of binge eating or very rapid intake of large am