N-terminal cysteine amino acid , Biology

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. 

ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATTCTTTATCCG

  M  S  L  P  Q  S  R  W  V  A  C F  S  I  E  G  I  L  Y  P

This gene encodes an enzyme in which the N-terminal cysteine amino acid is thought to be the active site of the enzyme. You have been asked to change this amino acid into a tryptophan to assess what effect this may have on its in vitro enzyme activity.

Design a site-directed mutagenesis experiment to perform this amino acid alteration; including showing the nucleotide sequences of the primers that would be required to make such a change. Design the primers to result in maximum efficiency of PCR product formation, which entails not only generating PCR product from the parental template, but also DNA that has been newly synthesised from the PCR reaction itself.

 

Posted Date: 3/11/2013 1:35:39 AM | Location : United States







Related Discussions:- N-terminal cysteine amino acid , Assignment Help, Ask Question on N-terminal cysteine amino acid , Get Answer, Expert's Help, N-terminal cysteine amino acid Discussions

Write discussion on N-terminal cysteine amino acid
Your posts are moderated
Related Questions
Q. Analyze the Regional Wall Motions? Ans. Various attempts have been made in the past to try and quantify the ischemic myocardium, however till date the best and most wid

Q. How can the presence, function of muscular tissue and localization in beings of the phylum Annelida is explained? In these beings there are a longitudinal muscular layer und

Gonial Apospory and Somatic Apospory Gonial Apospory There is no meiosis. The megaspore mother cell enlarges; a small vacuole appears above and below the nucleus. The c

What are the Luria's methods and theories Adhering to our theory that the Luria Nebraska bears little resemblance to Luria's methods and theories, there seems little point in i

Define the Disturbances in Fluid Balance? The correct functioning of cells and tissues depends on appropriate concentrations of nutrients; so any abnormal loss or accumulation


Match each item in Column A with the corresponding item in Column B regarding infectious diseases Column A Column B a. Pulmonary tuberculosis i. Enteric infectious protozoan diseas

State the term in detail hydrostatic skeleton. Formed from a fluid-filled and closed cavity surrounded by a body wall comprising muscles oriented in different directions. Muscu

what are the physiological adaptation shown my prey as defence

How would you design, in principle, an experiment to test the hypothesis that a certain variety of lettuce seed needed daylight in order to germinate?  You would need as large