N-terminal cysteine amino acid , Biology

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. 

ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATTCTTTATCCG

  M  S  L  P  Q  S  R  W  V  A  C F  S  I  E  G  I  L  Y  P

This gene encodes an enzyme in which the N-terminal cysteine amino acid is thought to be the active site of the enzyme. You have been asked to change this amino acid into a tryptophan to assess what effect this may have on its in vitro enzyme activity.

Design a site-directed mutagenesis experiment to perform this amino acid alteration; including showing the nucleotide sequences of the primers that would be required to make such a change. Design the primers to result in maximum efficiency of PCR product formation, which entails not only generating PCR product from the parental template, but also DNA that has been newly synthesised from the PCR reaction itself.

 

Posted Date: 3/11/2013 1:35:39 AM | Location : United States







Related Discussions:- N-terminal cysteine amino acid , Assignment Help, Ask Question on N-terminal cysteine amino acid , Get Answer, Expert's Help, N-terminal cysteine amino acid Discussions

Write discussion on N-terminal cysteine amino acid
Your posts are moderated
Related Questions
Bacteria called extremophiles are able to grow in hot springs such as Old Faithful at Yellowstone National Park in Wyoming. Do you think that the DNA of extremophiles would have a

What are the main events of the final mitotic period? The final mitotic phase is telophase. In telophase the following events happens: decondensation of chromosomes, every set

EFFECT OF ALCOHOL - 1 .       EFFECT ON NERVOUS SYSTEM - Alcohol has an anesthetic effect on nervous system. It affects orientation, alertness, coordination, judgement

Role of The American Dietetic Association The American Dietetic Association (ADA) remarked on the role of the dietitian in feeding dilemmas as:  the dietitian,  like other heal

Microorganisms Acquired During Transport, Handling and Processing of Raw Foods Microorganisms can come from truck, tanker, food handlers and equipment and utensils used in the

HOW ARE THE ORIGIN AND EVOLUTION OF ALGAE..

Q. Keys for identification of taxonomic work? Identification is an integral part of all taxonomic work. It is the recognition of certain, characters of flower, fruit, leaf or s

Q. What are the main biological functions of water? Water is the basic solvent for chemical reactions of living beings; it is the main means of substance transportation in the


Which of the following is true for a toe motor neuron that excites a toe muscle that moves the big toe in the right foot? A. The cell body of the toe motor neuron is located in