Explain the uses of isP in infant formulas, Biology

Assignment Help:

Explain the Uses of ISP in Infant formulas

Infant formulas 

Infant formulas, where milk solids have been changed by soy products, are well established commercial products. ISP is the preferred soy ingredient, because of its blandness, absence of flatus-producing sugars and negligible fibre content. The principal market for these products is lactose-intolerant babies. However, soy protein based dietetic formulas are finding enhancing use in geriatric and post-operative feeding as well as in weight reduction programs.

 


Related Discussions:- Explain the uses of isP in infant formulas

Explain protein deficiencies in nutritional care, Explain Protein Deficienc...

Explain Protein Deficiencies in Nutritional Care? A depleted amino acid pool leads to poor wound healing (dehiscence), delayed healing of fractures, anaemia, depressed pulmonar

Types of leukemia, Types of Leukemia Leukaemia may be chronic  or acut...

Types of Leukemia Leukaemia may be chronic  or acute and is classified  into  the  following  categories:  i)  Acute Lymphocytic Leukaemia (ALL) This is  the most comm

Determine the effect of iodine deficiency, Determine the Effect of Iodine D...

Determine the Effect of Iodine Deficiency? Iodine deficiency affects all populations at all stages of life, from the intrauterine stage to old age. However, pregnant women, lac

What is immune complex, It is a complex of antibody bound to antigen, which...

It is a complex of antibody bound to antigen, which contains complement components.

Free-hand sectioning of plant tissue (stem), What are the processes involve...

What are the processes involved in the preparation of plant tissue for free hand sectioning?

Aim of diabetes counselling, Aim of Diabetes Counselling Diabetes is a...

Aim of Diabetes Counselling Diabetes is a life-long illness. Diagnosis of diabetes has psychological and physical implications. Preventive counselling and life style change ca

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

How does the contraceptive diaphragm work, Q. How does the contraceptive di...

Q. How does the contraceptive diaphragm work? What are the limitations of this contraceptive method? The contraceptive diaphragm is an artifact made of plastic or latex that wh

Fission - asexual reproduction, Normal 0 false false false ...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd