Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Phosphofiuctokinase-I
Phosphofiuctokinase-I is activated by AMP and inhibited by ATP and citrate. When ATP is utilized in energy requiring process, the concentration ofAMP is highly increased. Thus a large increase in AMP acts as ametabolic amplifier of a small change in ATP. This mechanism allows the activity of phosphofructokinase-1 to be highly sensitive to even small changes in energy status ofthe cell and to control the quantity of carbohydrate undergoing glycolysis prior to its entry into citric acid cycle. The increase in AMP also explains why glycolysis is increased during hypoxia when ATP decreases.
Hypoglycaemia is defined as state of low blood glucose level of less than 50mg/dl. Low blood sugar level varies from person to person. Causes Since hypoglycaemia can occur in
What is the Importance of vitamin B 6 In the human and animal organisms, vitamin B 6 acts in the form of pyridoxal. In the form of 5'-orthophosphate (Pyridoxal-5'-phosphate),
Q. Foods for Growth in microorganisms? Microorganisms differ in their ability to use various nitrogenous compounds as a source of nitrogen for growth. The primary nitrogen sour
The eukaryotic cell can be separated into two major portions: the cell membrane that divides the intracellular space from the outer space phisically delimiting the cell; the cytopl
Describe in detail about the Psychological Testing Psychological testing is the third source of information about the child, and the source most often equated with neuropsychol
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Cell body in a neuron, the part which contains the nucleus and most of the cytoplasm and organelles. Cell cycle It is the sequence of events from one division of the cell to
Comparison between Metamorphosis in Amphibians and Insects You may have realized that the metamorphic process in amphibians and insects show certain fundamental similarity. M
Environment impact assessment (EIA) is a tool used for decision making regarding developmental projects and programmes and it may be defined as formal process used to predict the e
Micro Debrider: long , it's tip as hand spreader, not smooth and resemble H file. - These instruments have a hedstrom cutting configuration with a standard 0.02 taper and
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd