Solution-Viruses were first distinguished from other

Viruses were first distinguished from other microorganisms

Assignment Help Biology

Reference no: EM1345033

Question 1: The majority of viruses that have been identified to date cause disease.

Answer

True

False

Question 2: Viruses were first distinguished from other microorganisms, such as bacteria, based on which of the following (select one)?

Answer

A. Nucleic acid sequence

B. Size

C. Smell

D. Morphology in a light microscope

Question 3: You isolate a virus from a patient and are able to get a partial sequence of one of the viral proteins: Protein X

Sequence of Protein from Virus X SDNDLSLEDF

In addition, you are able to get partial sequence of the viral genome by deep sequencing of a clinical sample.

5’GAAGUCUUCCAGUGACAGAUCGUUGUCACU3’

Given this information, it is possible to determine that this virus is (select one)?

Answer

A. (+) RNA Virus

B. (-) RNA Virus

C. Retrovirus

D. (+) DNA Virus

Question 4: There are viruses that are known to infect which of the following entities (select all that apply)?

Answer

A. Animal Cells

B. Protists

C. Bacteria

D. Archaea

E. Plant cells

F. Prions

Question 5: Which of the following are characteristic of viral reproduction/replication (Select all that apply)?

Answer

A. The burst phase occurs just before the eclipse period.

B. Viruses require an eclipse period before infectious viral particles appear outside the cell.

C. Viruses undergo binary fission during eclipse period.

D. Viruses must assemble preformed subunits before whole viral particles can assemble

E. The latent period is longer than the eclipse period.

Question 6: A progeny infectious particle of a virus is called a [x]?

Question 7: Match the following viral assays with the process or macromolecule they are measuring.

Answer

Polymerase Chain Reaction

Read Answer Items for Question 7

Plaque Assay

Read Answer Items for Question 7

Hemagglutination Inhibition

Read Answer Items for Question 7

Deep Sequencing

Read Answer Items for Question 7

Polymerase Assay

Read Answer Items for Question 7

Answer

A. Genome sequence

B. Cytopathic Effect

C. Viral protein

Question 9: [x] are biologically active agents that are even more simple than viruses. These entities are composed of only a single molecule of RNA and can only infect plants.

Question 10: You are working in a clinical diagnostic laboratory and you receive a clinical sample from a pateint with a severe respiratory infection. Your perform a plaque assay on this clinical sample at various temperatures and using several different respiratory cell lines, but you never observe plaques. Based on this information, can you conclude that there are no viruses in this sample? Justify your answer in 3-4 sentences

Question 11: Due to the many diseases caused by viruses, we generally regard viruses as bad. Nevertheless, viruses may also have positive effects on organisms. Recent studies have shown that the mucosal linings of animals are highly enriched in bacteriophage. Explain in 2-3 sentences how this might be beneficial for an animal.

Question 12: If 10,000 infectious viral particles are added to tissue culture well containing 10,000 susceptible and permissive cells, which of the following will occur (select all that apply)?

Answer

A. A percentage of the cells will be infected with multiple viral particles

B. The Multiplicity of Infection (MOI) will be 1

C. Only one infectious cycle will occur

D. The Multiplicity of Infection (MOI) will be 10

E. A percentage of the cells will only be infected by one viral particle

F. Some of the cells will be uninfected.

Question 13: For the Herpes Simplex virus, only about 0.5% of viral particles added to a cell will result in a complete replication cycle (i.e. enter the cell, replicate its genome and exit the cell). In contrast, for lambda phage nearly 100% of the particles will be capable of completing a successful replication cycle. In 3-4 sentences, provide a plausible reason for the difference in active viral particles with HSV and lamda phage.

Reference no: EM1345033

Questions Cloud

Elucidate how an increased federal budget deficit resulting : Elucidate how an increased federal budget deficit resulting from a recession can actually help stabilize an economy.

Suppose that the mass of the planet is much smaller : A planet moves in an elliptical orbit around the sun. The mass of the sun is Ms. The minimum and maximum distances of the planet from the sun are R1 and R2, in that order.

Analogous steps in dimensioning computer network : Write down the analogous steps in dimensioning a computer network?

Explain why might it be appropriate for the government : Explain why might it be appropriate for the government to allow a pharmaceutical company to have a monopoly in the production of a drug.

Viruses were first distinguished from other microorganisms : Viruses were first distinguished from other microorganisms, such as bacteria, based on which of the following (select one)? The majority of viruses that have been identified to date cause disease.

Find out the average resistance force exerted : Perpetual motion machines have fascinated people especially inventors for hundreds of years before the laws of thermodynamics became known. Ideally, once energy is added to start a perpetual motion in machine, the machine would continue to operate..

Explain and discuss stages in a financial crisis : Explain and discuss three stages found within a financial crisis for the United States?

Find the conversion price of stock : The tsetsekos Corporation was considering to finance an expansion. The principal executives of the c orporation all agreed that an industrial company such as theirs should finance growth by means of common stock rather than by debt.

Find the companies total value with leverage : A firm is on the verge of a new product launch. Depending on how well product does in marketplace, three possible outcomes for next years valuation are: $210 m, $150 m or $60 m.

Reviews

Write a Review

Required(*) Message

Biology Questions & Answers

The endocrine system to the pony express

Both endocrine and nervous system are major regulating systems of the body; however, the nervous system has been compared to any post mail delivery system and the endocrine system to the pony express. In brief explain this comparison.

What type of non-mendelian inheritance is this

If you cross a black fur rabbit and a white fur rabbit, the resulting offspring look gray, when examining closely the fur of gray rabbit consist of both black and white hairs. What type of non-mendelian inheritance is this.

Full-time quadrupeds instead of full-time bipeds

What everyday tasks do you think would become more challenging if Homo sapiens were full- time quadrupeds in the place of full-time bipeds? Explain the answers in details.

Understanding the perception and sensation.

Specify whether the taste of fresh water surprised you or not? Explain if your perception of coarseness change or not?

What are the ratios of the phenotypes in f2

An inbred mouse that expresses Db and Kb is crossed with an inbred mouse that expresses no class I MHC. The F1 offspring are all DbKbKk.

Define how his geneticist friend should advise

A geneticist determines that long hair length in mink is dominant over short hair (recessive).define how his geneticist friend should advise.

What percent of the population are homozygous dominant

What percent of the population are homozygous dominant. What do you assume would be the effect on the switch of reversing orientation of one of the hix sites.

Alga has invaded waters of california

The U.S government has placed this strain of C.taxifolia on noxious weed list, which means that any possible source of the contamination of the weed will be highly restricted. Shipments that contain any kind of C.taxifolia and pass through an area wh..

What is the final pressure of the gas

Using the understanding of osmosis describe, why putting salt on a pork chop before cooking it on a grill is probable to result in a dry tough piece of meat.

What is the exact benefit relationship

Recent evidence shows that the individual chromosomes occupy fairly defined territories within the nucleus. Given the structure and location of parts of the nucleus, which would be more probably involved in chromosome location.

What sort of signalling occurs when insulin is secreted

What sort of signalling occurs when insulin is secreted from the pancreas and acts on muscle cells to increase glucose uptake.

Defining the significant terms in biostatistics.

Explain the study of hypothesis? Specify the outcome variables and also state how they were measured? Explain the study factors (exposures) and how were they measured?

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

Submit Assignment

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd