Is this a strand of dna or rna

Assignment Help Biology
Reference no: EM13936840

Use this single strand of nucleic acid * 5'- ATGCTATCATTGACCTTGAGTTATTAA -3' * and answer the following:

i) Is this a strand of DNA or RNA? How do you know?

ii) If DNA, what is the complementary strand?

iii) If this were the coding strand of a DNA molecule, what would the mRNA sequence be?

iv) If this were the non-coding strand of a DNA molecule, what would the mRNA sequence be?

v) If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein? (Hint: think about the code)

vi) What would happen to the reading frame if three bases were inserted/deleted? Why?

Reference no: EM13936840

How is flow of energy different in a photosynthesizing cell

Life requires energy. In a short essay (100-150 words), describe the basic principles of bioenergetics in an animal cell. How is the flow and transformation of energy differ

Enzyme charges at trnamolecule with appropriate amino acid

Which enzyme charges at tRNAmolecule with the appropriate amino acid? An alpha helix and a beta-pleated sheet aretypes of, Ribozymes in the large ribosomal subunitcatalyze pep

Trypsin is a serine protease with an identical mechanism

Trypsin is a serine protease with an identical mechanism to chymotrypsin, but cuts after positively-charged amino acids. Which of the following statements would you expect to

Fasciculus cuneatus-fasciculus gracilis-tectospinal tract

From the key choose the name of the tract that might be damaged when the following conditions are ovserved.Key: a.) fasciculus cuneatus b.) fasciculus gracilis c.) lateral c

Describe skullcandy functional level strategies

1. Apply Porter's Five Forces to analyze the attractiveness of the industry:  Is the industry attractive? Please explain. 2. Describe  Skullcandy's distinctive competencies, 

Development of transgenic organisms

The development of transgenic organisms is an established technique in many laboratories. A transgenic organism is an organism that includes DNA from another organism in the

Years of age developed gastroenteritis

Case study: Over 30 children younger than 3 years of age developed gastroenteritis after visiting a local water park. These cases represented 44% of the park visitors in thi

Describe vertical temperature strata

When you look out your window at noon, the snow had changed to rain, and later in the afternoon sleet was falling. This later turned to snow. As you are driving home from wo

Reviews

Write a Review

 
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd