Is this a strand of dna or rna

Assignment Help Biology
Reference no: EM13936840

Use this single strand of nucleic acid * 5'- ATGCTATCATTGACCTTGAGTTATTAA -3' * and answer the following:

i) Is this a strand of DNA or RNA? How do you know?

ii) If DNA, what is the complementary strand?

iii) If this were the coding strand of a DNA molecule, what would the mRNA sequence be?

iv) If this were the non-coding strand of a DNA molecule, what would the mRNA sequence be?

v) If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein? (Hint: think about the code)

vi) What would happen to the reading frame if three bases were inserted/deleted? Why?

Reference no: EM13936840

Describe the evolution of prokaryotes and eukaryotes

Can anyone explain the mechanism of evolution for prokaryotes and eukaryotes, Please use your own words and not copy from internet because I will not be able to understand

Dna complementary sequences and size

DNA is isolated from two different species. Both DNA samples are found to be exactly the same size. One of the DNA samples has a G+C/A+T ratio of 4.8 and the other 3.2.

Develop biofuels to free us from dependence on fossil fuels

Based on what you know about cellulose, what do you predict are the major advantage and disadvantage of using cellulose-rich plant material as biofuel? (Hint: Focus on cellu

Describe the broad classification of prokaryotic and eukaryo

Describe the broad classification of prokaryotic and eukaryotic genomes, indicating the various types of DNA molecules that are found in each and a detailed description of e

What is basis for affinity maturation in humoral responses

Does this contradict the tenets of clonal selection? Perhaps a bit more broadly, does this force rejection of the clonal selection hypothesis as a viable model to explain th

Explain how ray cells are formed through these tissues

List the tissues found in a segment of a three year old stem starting from the outside and moving to its center. Include both primary and secondary xylem/phloem, pith, corte

Autosomal recessivedisorder sickle-cell disease

Explain the terms penetrance, expressivity, and phenocopy in the context of the autosomal recessivedisorder sickle-cell disease, which results from an abnormalprotein (hemoglo

Identify plant and animal cell structure and functions

Identify plant and animal cell structure and functions. Explain the processes of photosynthesis and cellular respiration. Identify the relationships between reproduction, here

Reviews

Write a Review

 
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd