User Account

All Pages

Is this a strand of dna or rna

Assignment Help Biology
Reference no: EM13936840

Use this single strand of nucleic acid * 5'- ATGCTATCATTGACCTTGAGTTATTAA -3' * and answer the following:

i) Is this a strand of DNA or RNA? How do you know?

ii) If DNA, what is the complementary strand?

iii) If this were the coding strand of a DNA molecule, what would the mRNA sequence be?

iv) If this were the non-coding strand of a DNA molecule, what would the mRNA sequence be?

v) If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein? (Hint: think about the code)

vi) What would happen to the reading frame if three bases were inserted/deleted? Why?

Reference no: EM13936840

Questions Cloud

What is under armour doing to make brand personally relevant : 1. What is Under Armour doing to make its brand personally relevant, surprising, and easy to process?
Prepare summary journal entries for april : Prepare summary journal entries for April (without disposing of under- or overallocated conversion costs). Assume no direct materials variances.
What factors should sido consider before choosing a supplier : Which supplier should Sido choose? Show all calculations. What other factors should Sido consider before choosing a supplier?
Graded for technical content and from a grammar perspective : Write about Wal-Mart. It will be graded for technical content and from a grammar perspective. The paper should be approximately 2,000 words in length. References need to be cited throughout the paper and in the reference section
Is this a strand of dna or rna : If DNA and a base were inserted at the beginning of the 5' end of the molecule, how would that affect protein synthesis and the resultant protein? (Hint: think about the code), What would happen to the reading frame if three bases were inserted/del..
Two network security software tools : They must be of a type listed on page 22. Other types are not acceptable unless explicitly agreed by the module leader. c. They must be agreed with your module leader. The means of reaching this agreement are described below.
Explain the importance of pointers : Assuming an array has to be sorted, inserting a new element required shifting, in the worst case, n elements, where n is the number of elements in the array, i.e.:
What are the criteria for good primers in a pcr reaction : What are the criteria for "good" primers in a PCR reaction? Describe how you would use site-directed mutagenesis to change a BamHI restriction site into an EcoRI site.
Factors that influence buying behavior : Factors that influence buying behavior - Cultural, social, personal and psychological. Include consumers buying decision process.

Reviews

Write a Review

Biology Questions & Answers

  Dendrites of a single neuron

Explain how multiple signals may travel from the dendrites of a single neuron to the axon terminal of that same neuron.

  What is difference between obligate anaerobe obligate aerobe

What is the difference between an obligate anaerobe, obligate aerobe, chemoheterotroph, diazotroph, aerotolerant anaerobe, and facultative anaerobe?

  Lipase is a digestive enzyme that digest fat droplets

Lipase is a digestive enzyme that digest fat droplets inthe basic conditions(NaHCO3 is present) of the smallintestine. Indicate which of the following test tubes would showdigestion following incubation at 37 degreese C, and explaine whythe others..

  What is the likely cause of his headaches and visual problem

Explain the differences in population growth patterns of the two paramecium species. What does this tell you about how Paramecium aurelia uses available resources.

  What is a gametophyte

Explain how the centrosomes are produced for Meiosis I?

  Is an rna polymerase insensitive to

Is an RNA polymerase insensitive to ?-amanitin concentrated at the Poly-A site, the chromosomal territory, spliceosome, the nucleolus, or the chromosomal matrix protein?

  Describe the concentration-response relationship

Describe the differences between pharmacodynamics and pharmacokinetics and identify the differences between agonist, antagonist, and partial agonist. Describe the concentration-response relationship.

  Define particular bacterium had two dna molecules

particular bacterium had two DNA molecules in it, one that was 450 kilobases and one that was 550 kilobases, how would you decide if it had one chromosome and one plasmid, or two chromosomes?

  Balanced chromosomal translocation

The Disrupted in Schizophrenia 1 (DISC1) gene is disrupted by a balanced chromosomal translocation (1; 11) (q42; q14.3) in a Scottish family with a high incidence of major depression, schizophrenia, and bipolar disorder.

  Purpose of the uninoculated control

Phenylalanine deaminase positive and phenylalanine deaminase negative culture. Determine the purpose of the uninoculated control? What other types of controls would be useful to increase reliability of the test?

  What way may we be able to take advantage of retrotransposon

In what way may we be able to take advantage of retrotransposons in human gene therapy? How would this differ from our current use of retroviruses?

  What functional difference between ventricular hypertrophy

What is the functional difference between ventricular hypertrophy due to exercise and hypertrophy due to congestive heart failure?

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

Submit Assignment

Academics

Major Subjects

Majors

Get In Touch

whatsapp: +1-415-670-9521

Phone: +1-415-670-9521

Email: [email protected]

TERMS & POLICIES

HELP & SUPPORT

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd