Dna sequence shows a gene encoding a smallpolypeptide

Reference no: EM13534817

The following DNA sequence shows a "gene" encoding a smallpolypeptide. The start codon is AUG and the three "stop" codons are UAA, UAG, and UGA. The promoter region of the DNA is inparetntheses.

5' (ATGACGTATAA) TGACCGTACATGAGTAATACATAAATCAG 3'
3' (TACTGCATATT) ACTGGCATGTACTCATTATGTATTTAGTC 5'

using the mRNA codon chart, transcribe and translate the"gene" from above.

a) which DNA strand did you choose as the template strand? Topor bottom? Why?

b) mRNA sequence (not including promoter region)=

c) mRNA sequence from start to stop codon=

d) anticodons for each codon=

e) amino acid sequence (including start amino)=

Reference no: EM13534817

Questions Cloud

Explain why are the carbon atoms counted from left to right : To me these seem like the should be counted the same way but one is counted from left to right and one from right to left. Why is that. What is the rule. Keep in mind that I am a new chemistry student.

What is the annual money growth rate : Discuss the short-run effect on output, unemployment, general price level and interest rate with a substantial increase In the factor cost of production.

Explain permanent dipoles and temporary dipoles : In non-ionic compound, the two primary sources of intermolecular forces are permanent dipoles and temporary dipoles. Explain what causes each of these types of dipoles to form.

Ratios expected for crosses involving parental genotypes : Dr. Paul is blood type O. His father was blood type A and his mother was blood type B. What were the genotypes of his parents and what are the possible blood types and ratios expected for crosses involving these parental genotypes?

Dna sequence shows a gene encoding a smallpolypeptide : The following DNA sequence shows a "gene" encoding a smallpolypeptide. The start codon is AUG and the three "stop" codons areUAA, UAG, and UGA. The promoter region of the DNA is inparetntheses.

Calculate what is its average acceleration : A hockey puck is hit on a frozen lake and starts moving with a speed of 13.4 m/s. Five seconds later, its speed is 5.40 m/s. What is its average acceleration

What is the percentage increase in the gdp deflator : Find the nominal GDP for the current year and the base year and what is the percentage increase in the CPI - what is the percentage increase in the GDP deflator

High level of pfr isregenerated by a pulse irradiation : Explain the following statement: “If a high level of Pfr isregenerated by a pulse irradiation with red light in the middle of dark period, this will inhibit flowering in short-day plants and promote flowering in long-day plants.

What is the normal force on the object in newtons : An object with a mass of 23 kg lies on a horizontal frictionless surface. What is the normal force on the object in Newtons

User Account

All Pages