What is a uml diagram?

Assignment Help Basic Computer Science
Reference no: EM13161707

What is a UML diagram? What does it include? Why is it used? What would the UML diagram look like for our lab assignment? This is for computer programming 

Reference no: EM13161707

Questions Cloud

Develop a class airborne location : develop a class AirborneLocation that represents the location of airplanes with respect to a reference radar location. Each AirborneLocation object should include data member for aircraftID (integer),
Write a recursive method to reverse a string. : write a recursive method to reverse a string. Explain why you would not normally use recursion to solve this problem?
What is the goal of information systems planning? : What is the goal of information systems planning? What are the steps of the traditional systems development life cycle? What is prototyping? What is an RFP? What is typically included in one? How is it used?
What is a knowledge repository? : What is a knowledge repository? What is a community of practice? What is a chief knowledge office? What are his or her duties? What is natural language processing? What are the three (3) levels of voice recognition? What is a learning system?
What is a uml diagram? : What is a UML diagram? What does it include? Why is it used? What would the UML diagram look like for our lab assignment? This is for computer programming
Two types of sporting teams : Select two types of sporting teams and de?ne subclasses for them. These classes shouldinherit from a base team class such as that created in Exercise 1. Include uniquecharacteristics about the sport.
Create a c++ console application : Objective: Create a C++ console application that will model the characteristics of a resistor. Create a multifile project. Create and add to the project an h file containing the resistor-class definition. Create and add to the project a cpp file cont..
Set of strings of balanced parentheses : Show that the set of strings of balanced parentheses is not defined by any regular expression. Hint: The proof is similar to the proof for the language E above. Suppose that the set of balanced strings had a deterministic finite automaton of m states
Application named arithmeticmethods : Create an application named ArithmeticMethods whose main() method holds two integer variables. Assign values to the variables. In turn, pass each value to methods named displayNumberPlus10()

Reviews

Write a Review

Basic Computer Science Questions & Answers

  Differences between technical and technology skills

Describe in scholarly detail differences between technical and technology skills as they associate to telecommunications and how they relate to general expectations

  Input devices

Compare how the gestures data is generated and represented for interpretation in each of the following input devices. In your comparison, consider the data formats (radio waves, electrical signal, sound, etc.), device drivers, operating systems suppo..

  Explaining dns zone in secure dynamic updates

If a DNS zone accepts only secure dynamic updates and the DHCP server is a member of the DnsUpdateProxy security group.

  Perform the usual operations on circle

You should be able to perform the usual operations on the circle, such as setting the radius, printing the radius, calculating and printing the area and circumference.

  What sort of system are you building

Create a spreadsheet listing all of the components, their prices, the place or website you could purchase, the cost of each component, and an explanation of why you would choose this part - What sort of system are you building? What tasks are requi..

  How to perform testing for each development method

Research, write, and give 4-6 page proposal of alternative methods Smith Consulting might consider for finishing Frequent Shopper Program. Describe how Smith would perform testing for each development method.

  Determine access time when there is cache miss

Determine the access time when there is cache miss? Suppose that cache waits until line has been fetched from main memory and then re-executes for hit.

  Identify position-indicate what pattern is found in thread

Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

  Explain ibm plan to give its it assets-intellectual property

Will IBM's plan to give away some of its IT assets and intellectual property also increase its support of open-source software products like Linux.

  Explaining statement for security policy

Write a statement for security policy for the following:Let LAN for small 100-person business, Pixel Inc. Business occupies one floor in office building. Everybody has a computer on his or her desk.

  Explain findings after conducting search for .cde files

You work for mid-sized corporation known for its inventions which does a lot of copyright and patent work. Explain your findings after conducting Internet search for .cde files.

  Sketch hierarchy chart and draw logic for program

Sketch the hierarchy chart and draw the logic for program which comprises housekeeping, detail loop and end-of-job modules and which computes service charge customers.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd