User Account

All Pages

Shorthand notation for a normal female karyotype

Assignment Help Biology
Reference no: EM131134574

1. A SNP marker has 3 alleles in a population: A, T and C. The population frequencies of the 3 alleles are pA = 0.2, pT = 0.5 and pC = 0.3, respectively. Assuming random mating (Hardy-Weinberg equilibrium), the frequency of A/T genotypes is______ , the frequency of A/C genotypes is______ and the frequency of T/C genotypes is______ .

2. A boy who is born to healthy parents that are siblings (brother and sister) is an example of______ mating and may be at higher risk for______ diseases.

3. A point mutation that changes a codon from GAU to GAA is an example of a ________ mutation.

A. synonymous

B. missense

C. nonsense

D. harmful

E. silent

4. The shorthand notation for a normal female karyotype is ________.

A. 47,XXY

B. 48,XXYY

C. 46,XY

D. 44,XX

E. 46,XX

5. A chromosome with a centromere located in the middle of the chromosome roughly equidistant from the two telomeres is ________.

A. metacentric

B. submetacentric

C. telocentric

D. acrocentric

E. eccentric

6. The ________ technique can be used to collect a sample of fetal cells for genetic testing using only a blood sample from a pregnant woman.

A. chorionic villi sampling

B. amniocentesis

C. fetal cell sorting

D. nuclear fission

E. none of the above.

7. Which of the following is NOT a DNA repair mechanism that exists in humans?

A. Photoreactivation repair

B. Double-stranded break repair

C. Excision repair

D. Mismatch repair

8. An oncogene can arise by a ______ of a ______.

9. The mature mRNA transcript for a gene with one exon is originally

5' AUGAGGGAAUCCCCUAGGUGA 3'

and a mutation inserts an additional G nucleotide after position 7 in the DNA sequence so that the mutated gene produces the modified mature mRNA transcript

5' AUGAGGGGAAUCCCCUAGGUGA 3'

The amino acid sequence of the protein coded by the original gene is ______ and the amino acid sequence of the protein coded by the mutated gene is ______ . This is an example of a ______ mutation. If 3 G nucleotides were instead inserted after position 7 it would be an example of a ______ mutation.

Reference no: EM131134574

Questions Cloud

There were no dividends in arrears on preferred stock : There were no dividends in arrears on preferred stock. During 2010, the company had the following transactions and events.
Draw the marginal-benefit and marginal-cost curves : Draw the marginal-benefit and marginal-cost curves and show the optimum level of pollution abatement. (Related to Application 1 on page 663.)
How does sickle cell anemia relate to population genetics : How does sickle cell anemia relate to population genetics? How is more protein product created than amount of genes in the genome
Weiser corporation had the following stockholders : Enter the beginning balances, and post the entries to the stockholders' equity accounts.
Shorthand notation for a normal female karyotype : The shorthand notation for a normal female karyotype is ________
How do psychological resources help to eliminate stress : Social resources are very easy for people to obtain to decrease stress. What are social resources? If you had a client that asks for guidance in social resources to help them to cope, what would you recommend they try? What is the reason these res..
Corrected an error that had understated the net income : Issued 50,000 shares of common stock as a result of a 10% stock dividend declared onDecember 15, 2009.
What scenario is the median voter more likely to vote : Consider the scenario that is least favorable to the median voter. Under what conditions will the median voter vote in favor of public schooling?
A suitable layout that minimizes transportation costs : Eight work centers must be arranged in an L-shaped building. The locations of centers 1 and 3 are assigned as shown in the accompanying diagram.

Reviews

Write a Review

Biology Questions & Answers

  Does pancreatic amylase found in blood any activity

Does pancreatic amylase found in blood any activity as it circulates in the blood plasma?

  Describe the vaccination process

A booster shot is another dose of the original vaccine given some time after the original dose wasad ministered

  The evolution of disease resistance in domestic turkeys

If we observe that domestic turkeys are less resistant, does that necessarily mean that wild females had been choosing more-resistant males, or are other hypotheses equally plausible? Please include at least one scientific research article to supp..

  Q what organism produces the disease and howwhat are the

q. what organism produces the disease and how?what are the four different locations where an anthrax infection can

  Underlying molecular basis of inheritance

Assume you are part of a team of scientists exploring a small, newly found island. This island is located approximately 150 miles off the coast of the mainland.

  Q1 mr simpsons father and mrs simpson brother each have the

q1. mr. simpsons father and mrs. simpson brother each have the same rare autosomal recessive disorder. mr. and mrs.

  What would keep a cells cytosol is opotential

What would keep a cell's cytosol isopotential? What would happen iflocal potential differences arose in the cytosol?

  List the organ systems that are directly involved

List the organ systems that are directly involved when one eats a meal and explain how they are involved

  Describe the bodys mechanisms for controlling blood glucose

describe the bodys mechanisms for controlling blood glucose levels under normal and stress conditions. write your

  Discuss the gradual appearance of significant ecological

Discuss the gradual appearance of significant ECOLOGICAL synapomorphic traits (advance shared ecologically functional properties among taxa) that have evolved during the colonization of land by plants, from simpler.

  Distribution of long and short stemmed dandelions

At the starting of the spring, Dr. Betty Burner notices that there is an equal distribution of long and short-stemmed dandelions in her backyard.

  Joan hawthorne and john sperling

Joan Hawthorne and John Sperling, the founder of University of Phoenix, helped to start cloning pets in 1997, beginning with Hawthorne's aging dog, Missy (called the Missyplicity Project). How is cloning of organisms (also called somatic nucle..

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

Submit Assignment

Academics

Major Subjects

Majors

Get In Touch

whatsapp: +1-415-670-9521

Phone: +1-415-670-9521

Email: [email protected]

TERMS & POLICIES

HELP & SUPPORT

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd