Zoonoses disease-brucellosis, Biology

Brucellosis

Brucellosis is a global problem because of its public health and economic implications. It is one of the serious diseases affecting livestock all over the worlds that can be transmitted to human beings through the ingestion of contaminated animal products and handling of infected animals. Brucellosis is an occupational hazard in farming, veterinary practice and meat processing, where Brucella can enter through the skin, particularly in areas of minor abrasions. In animals, it tends to localize in the genital tract but it involves the reticuloendothelial system in humans. Brucellosis is caused by several species of Brucella, viz. B. abortus, B. melitensis, B. suis. B. canis and B. ovis. A human being gets infected with Brucella through ingestion, contact, inhalation and accidental inoculation. Goats, sheep, cattle, water buffaloes and swine are the principal group of animals which serve as sources of human infection. Unpasteurised milk, butter, cream and cheese prepared from milk obtained from infected animals are commonly involved in the transmissions. Meat and meat products, particularly when they are not properly cooked, are a potential source of infection. The vaginal discharges, fetuses and placenta of infected animals are the richest sources of Brucella infection. Contact with these materials as well as contact with urine, manure and carcasses is mainly responsible for occupational brucellosis.Infection is common in veterinarians, farmers, packing-house workers, animal handlers, factory workers engaged in primary processing of wool, and abattoir and laboratory workers. Laboratory workers and veterinarians also are exposed frequently to the risk of infection by accidental inoculation or inhalation.


Clinical features: The incubation period is variable. It is usually 10 to 30 days but sometimes takes several months. The onset of the symptoms is usually insidious with  malaise, chills, fever, sweats, weakness myalgia and headache. Fever may be remittent particularly with B. melitensis (undulant fever). Bodyache, particularly backach, headache, insomnia, and anorexia are common and a nonarticular arthralgia develops affecting the knee, ankle, shoulder or elbow. There is weight loss. Infection with B. abortus is usually milder than with B. suis or B. melitenis.


Laboratory diagnosis: Laboratory tests for diagnosis of human brucellosis include bacteriological, serological and allergic tests. Bacteriological tests for isolation of the organism, serum agglutination test (plate and tube agglutination test), complement fixation   test/ Coomb ’s   test ,   indirect   haemagglutination   test ,   indirect immunofluorescence test, intradermal test are the various tests used fordiagnosis. Molecular diagnosis is done by polymerase chain reaction (PCR) using their specific primers.


Control and prevention:
Strict hygienic and sanitary conditions are the primary measures for controlling brucellosis, particularly in the occupational group. The following measures are helpful in eliminating the infection:
1.  Adequate heat treatment of all consumable products of animal origin.
2.  Use of protective clothings by the occupational groups at risk.
3.  Removal of the after birth and excreta of animal and their sanitary disposal.
4.  Disinfection of farm premises, animal sheds, and abattoirs, etc.
5.  Control of animal brucellosis which will eventually eliminate human brucellosis.

Posted Date: 9/20/2012 2:18:28 AM | Location : United States







Related Discussions:- Zoonoses disease-brucellosis, Assignment Help, Ask Question on Zoonoses disease-brucellosis, Get Answer, Expert's Help, Zoonoses disease-brucellosis Discussions

Write discussion on Zoonoses disease-brucellosis
Your posts are moderated
Related Questions
Q. Are the veins or the arteries constituted of more muscle tissue? How different are the walls of these two kinds of blood vessels? The arterial system has thicker muscle wall

State the term - Neuropsychological Examination For a neuropsychological examination a battery of tests administered should include, at a minimum: Intelligence Tests

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Define the lens transparency in metabolism of lens. Lens Transparency: a. Transparency depends on avoidance of large transitions of refractory index. This is in other wor

Q. What is tuberculosis? How is the disease transmitted? Is there treatment for tuberculosis? The Tuberculosis is a disease caused by the Mycobacterium tuberculosis bacteria wh

Considering hybridization in a given trait like the color of the hair of a mammalian species (white/black) conditioned by a pair of different alleles under complete dominance (blac

In a school laboratory, what is usually regarded as evidence that photosynthetis has occurred in a plant

vulture undergo which type of nutrition

ATP The energy currency of the body One of the monomers used in the synthesis of RNA Contains three phosphate groups àhigh energy Removal of one releases e

Please on 3 separate paragraph a. Examine the contributions of select scientists from the Greek and Roman period. b. Explore the Arab influence on the development of anatomy