What are social dangers, Biology

Members belonging to the scientific community fear the misuse of this therapy leading to dangerous consequences.  People may try to insert the desired gene, for example, the gene for tallness, intelligence etc and play with the natural system. 

Any scientific development if not used in a righteous manner may lead to blunders and gene therapy is no exception. Almost all developments in medicine are associated with side effects similar to gene therapy. One should identify the factors which may lead to the setbacks in gene therapy like faulty vectors, lack of chances for clinical investigation etc. It is a wonderful technology which can eradicate large number of genetic disorders. Hence, instead of being skeptical, it is time to move ahead and accept this technology (Elias and Annas, N.D).

 

Posted Date: 8/9/2012 6:37:39 AM | Location : United States







Related Discussions:- What are social dangers, Assignment Help, Ask Question on What are social dangers, Get Answer, Expert's Help, What are social dangers Discussions

Write discussion on What are social dangers
Your posts are moderated
Related Questions
describe each and every step in nutrition in animals?

Late recurrence of artgirza: This is a reflection of progress of disease in the native coronary arteries distal to the grafts or narrowing or blockage of one or more of the g

Define Total Body Potassium (TBK)? Potassium in the body is an index of body's total cell mass. A gamma counter measures the amount of a type of potassium which is assumed t

what are protein? What is the constituential uni. Of protein? Briefly explain the various forms of protein?

what about cytoplasmic sex determination

What are some significant neurotransmitters? The following are some neurotransmitters: adrenaline (epinephrine), noradrenaline (norepinephrine), dopamine, acetylcholine, seroto

Pollination Many flowering plants rely on animals such as bees, butterflies, moths, wasps, beetles, birds, and bats for pollination to produce fruit. Thirty percent of our food


F o wl cholera Fowl cholera, a highly contagious disease of poultry caused by Pasteurella multocida, was one of the first infectious diseases to be recognized by Louis Past

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT