Treatment and disposal technologies for health-care waste, Biology

Q. Treatment and disposal technologies for health-care waste

1. Incineration

2. Chemical disinfection

3. Wet and dry thermal treatment

4. Microwave irradiation

5. Land disposal

6. Inertization

Posted Date: 7/27/2013 5:45:14 AM | Location : United States







Related Discussions:- Treatment and disposal technologies for health-care waste, Assignment Help, Ask Question on Treatment and disposal technologies for health-care waste, Get Answer, Expert's Help, Treatment and disposal technologies for health-care waste Discussions

Write discussion on Treatment and disposal technologies for health-care waste
Your posts are moderated
Related Questions
Q. What are the main factors that affect the growth of a population? The major factors that make populations grow are births and immigration. The major factors that make popula

A (w+/ w+) red-eyed Drosophila female is crossed with a white-eyed male. Assuming the trait for eye colour is sex-linked, what are the possible phenotypes of the progeny?

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Airway Management To improved ventilation, suctioning, IPPB, Ultrasonic mist therapy and postural drainage with clapping and vibrating are all employed to halt the progress o

Which of the following is TRUE about the properties of aqueous solutions? Select one: a. A pH change from 5.0 to 6.0 reflects an increase in the hydroxide ion concentration (

Explain what is Correction of Hypovolemia ? Intravenous fluids should be given to correct hypovolemia and optimize preload to the heart. This is particularly important in sept


Q. Fats requirements during congestive cardiac failure? Fat: The quantity and quality of fat would be governed by the severity of hyper- lipidemia and adiposity. Emphasis, as

what is the function of the bladder in the bladder worm

Sour taste is usually due to the presence of acids such as acetic acid, citric acid, benzoic acid. Upon dissociation, the acids give H ions which impart acidity. More the H ion con