porifera, Biology

what are the general characteristicss of porifera
Posted Date: 4/12/2012 7:22:14 AM | Location : United States







Related Discussions:- porifera, Assignment Help, Ask Question on porifera, Get Answer, Expert's Help, porifera Discussions

Write discussion on porifera
Your posts are moderated
Related Questions
What is black mold? Mold is a fungus. Black mold is not an official term, since it is not possible to tell with the naked eye what type of mold is present, and many of them app

Please help with the following: a) Draw a diagram (showing all the C and H atoms, and their bonds) for a hydrocarbon with 5 carbons with a double bond between carbons 2 and 3.

Q. Define Low - density lipoprotein? Ans. LDL is the major cholesterol-rich lipoprotein carrying approximately 70 per cent of plasma cholesterol. It serves to transport ch

How plants solve the problem of transporting substances throughout their tissues? In the bryophytes the substance transport is done by the diffusion. In the tracheophytes (pter

State two ways in which sulphur dioxide emissions from coal-fired generating stations could be reduced. Sulphur dioxide emissions can be reduced by fitting desulphurization pl

A fatty acid having of a hydrocarbon chain and a terminal carboxylic acid group that is shown in the figure.  Most  fatty  acids  are  in  biology  have  an  even  number  of carbo

Diagnosis of diabetes mellitus which included history taking, symptoms and signs and various tests which can be done to diagnose a case of diabetes. Diabetes Mellitus (DM) or diabe

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Define effect of Caffeine on athletes? Caffeine is found in coffee, tea, colas and chocolates. Its doses at 3- 6 mg/d have been known to increase muscle contractility and aerob

Explain Extra Cardiac Conduit Fontan ? This can be done with or without cardipulmonary bypass. First step is to make a bi-directional Glenn shunt. The main pulmonary artery is