Tapetum - anther wall layers, Biology

Tapetum - Anther Wall Layers

Tapetum is the innermost and most important layer of the anther wall. It is generally composed of a single layer of cells. These cells completely surround the sporogenous tissue, and they attain maximum development when the sporogenous tissue is at the tetrad stage. The tapetum is of dual origin in most of the angiosperms; the cells of the outer side originate from the derivatives of the PPCs, while those of the inner portion originate from the cells of the connective. Usually tapetal cells of different origin also appear different in size and structure. Tapetum of dual origin is also known as dimorphic tapetum. In Alectra thomsoni, the tapetal cells on the outer side are much smaller than those on the inner side.


Figure: (a) Diagrammatic sketch of transverse section of an anther showing the position of tapetum. (b) A few cells enlarged to show the dense cytoplasm and multinucleate condition of the tapetal cells.

Posted Date: 1/23/2013 12:33:51 AM | Location : United States

Related Discussions:- Tapetum - anther wall layers, Assignment Help, Ask Question on Tapetum - anther wall layers, Get Answer, Expert's Help, Tapetum - anther wall layers Discussions

Write discussion on Tapetum - anther wall layers
Your posts are moderated
Related Questions
Explain the Stochasticity? Ubiquitous noise in biological systems creates stochastic methods central to modelling attempts. Stochasticity is available at all levels in environm

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Critical Thinking Why is it necessary to use the same restriction enzyme to cut two pieces of DNA that are to be joined together? As each restriction enzyme recognizes a specif

write down the division of cryptogamae and phanerogamae

Marasmus is a disease due to the deficiency of both proteins and calories.The child is weaned out before one year of age and is given a diet low in both proteins and carbohydrates.

Define interaction of vitamin c with Nicotinic acid? NAD, NADP and NMN act as constituents of the hydrogen transferring coenzymes in glycolysis, Kreb's cycle and in the oxidati

Green leaves make food for plants Heat some alcohol in a jar over boiling water unless it boils. Break various green leaves from a geranium or other plant which has been in the

Caution for the use of Pipettes - Food Microbiology? (1) Never do pipetting with mouth. (2) For culturing, sterilized pipettes should be used. (3) Never keep pipettes on

Define Principle of Detection of Metanil Yellow? Non-permitted colours like lead chromate, metanil yellow, auramine, rhodamine B are used to brighten the foods especially spice

Q. Reduction in left ventricular? Vasodilators improve stroke volume, and reduce degree of regurgitation. This results from decrease in systemic vascular resistance and leads t