Sequence for the beta actin gene, Biology

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning

Posted Date: 3/23/2013 2:04:13 AM | Location : United States

Related Discussions:- Sequence for the beta actin gene, Assignment Help, Ask Question on Sequence for the beta actin gene, Get Answer, Expert's Help, Sequence for the beta actin gene Discussions

Write discussion on Sequence for the beta actin gene
Your posts are moderated
Related Questions
Q. What is mitral stenosis? Most common cause of mitral stenosis is rheumatic fever. Nearly 30 per cent of patients with rheumatic fever may go on to develop pure mitral valve

Q. What are the euchromatin and heterochromatin? Chromatin is uncondensed nuclear the DNA the typical DNA morphology in interphase the phase of the cell cycle in which the cell

Q. A netlike membranous complex of superposed flat saccules with vesicles detaching from the extremities seen in electronic microscopy. What is the observed structure? What is its

Explain Lyme disease The disease - About 70-80% of patients infected by B. burgdorferi develop the characteristic skin lesion, erythema migrans, which occurs at the site of the

What are the three parts of a DNA nucleotide, and how are they connected to each other? The three types are a deoxyribose sugar, a phosphate group, and a nitrogenous base. The

Explain about Osteogenesis Osteogenesis, large amounts of woven bone can be formed very rapidly. This bone is believed to be much more compliant than organized lamellar bone. I

Q. What is the pollination? What are the major forms of pollination? The procedure in which pollen grains (the male gametophytes of phanerogamic plants) reach the female gameto

Phylum Sarcdina 1) They move by means of pseudopodia (ralse feet) or similar structures. 2) They feed heterotrophically by phagocytosis.   Some examples: Amoeba, Entamo