Sequence for the beta actin gene, Biology

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning

Posted Date: 3/23/2013 2:04:13 AM | Location : United States







Related Discussions:- Sequence for the beta actin gene, Assignment Help, Ask Question on Sequence for the beta actin gene, Get Answer, Expert's Help, Sequence for the beta actin gene Discussions

Write discussion on Sequence for the beta actin gene
Your posts are moderated
Related Questions
Symptoms refer to the problems expressed by the patients. Signs are obtained by a health professional from the patients by interacting with him, by conducting tests, etc. The sympt

Q. Observation of Hemichordata ? • identify Balanoglossus as a hemicliordate and give its scientific and common name. • classify Balanogiossus LIP to the level of order.

Respiratory Distress Syndrome: Respiratory distress in a  newborn is  a challenging problem.  It  accounts for significant morbidity and mortality. It occurs  in  4 to 6 per c

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Q. Define the Purposes of Counselling? 1. Supporting individuals to take charge of their own life by: Providing information; Facilitating emotional adjustments; and

Explain Procedure for Gram Staining of Bacterial Cultures? Now carry out the exercise following the steps enumerated herewith. 1. Prepare bacterial smear on a clean, non-gre

Q. How different is the simple squamous epithelium from the stratified squamous epithelium? Where can these epithelia are found in the human body? The simple squamous epitheliu

During mitotic anaphase is there separation of homologous chromosomes or separation of identical chromatids? In the anaphase of mitosis the identical chromatids separate and co

Explain the Pipettes - Food Microbiology? Sterile glass pipettes or disposable pipettes can be used for transferring the known volume of liquid or culture aseptically. Steriliz

GER M PLASM THEORY - It was proposed by Weismann. According to it, two types of cells are formed during embryonic development viz - Germ cell & Somatic cell. The germ ce