Sequence for the beta actin gene, Biology

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning

Posted Date: 3/23/2013 2:04:13 AM | Location : United States







Related Discussions:- Sequence for the beta actin gene, Assignment Help, Ask Question on Sequence for the beta actin gene, Get Answer, Expert's Help, Sequence for the beta actin gene Discussions

Write discussion on Sequence for the beta actin gene
Your posts are moderated
Related Questions
Q. Acute diarrhoea? It must be evident from the table above that acute diarrhoea generally occurs in association with infections, poisons and drugs. Chronic diarrhoea on the ot

PHYSIOLOG Y OF RESPIRATION - 1 .      EXCHANGE OF GASES - It is Haemotasis. It takes place in Alveoli between alveolar air and arterial cappilary by diffusion i.e., f

Glanders The glanders is caused by Burkholderia mallei (previously known as Malleomyces mallei) and it is a serious contagious disease of equines. Infected equidae are the reservo

Explain the neuritic type of infantile beriberi? It is also referred to as Wernicke korsakoff syndrome or cerebral beriberi. It shows typical manifestations of peripheral neuro

Simple Febrile Convulsions These are convulsions associated with fever and infection, and is commonest causes of seizures during infancy and early childhood. These convulsio

Why do you think the energy requirements are different in situations? Well the requirement is dependent on the ways in which the body spends energy. For example in the first c


Q. Concerning their biological function what is the difference between DNA and RNA? DNA is the source of information for RNA production (transcription) and thus for protein syn

A saline drip is to be prepared for a lab experiment that is looking at hydration in lab rats. Calculate the amount of NaCl need to make 4 liters of a 0.9% solution.

Determine the main four events of bone remodeling Quiescence refers to the resting state of the bone surface. This includes all of the bone surfaces. Activation is the recr