Sequence for the beta actin gene, Biology

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning

Posted Date: 3/23/2013 2:04:13 AM | Location : United States







Related Discussions:- Sequence for the beta actin gene, Assignment Help, Ask Question on Sequence for the beta actin gene, Get Answer, Expert's Help, Sequence for the beta actin gene Discussions

Write discussion on Sequence for the beta actin gene
Your posts are moderated
Related Questions
describe the diversity in the feeding habits and locomotion of annelids

STRUCTUR E OF A MYOFIBRIL - The dark bands of the myofibril are termed the A-bands (Anisotropic bands). Each A-band has at its middle a light zone called H-zone (Henson'

Explain the term- PUPIL Pupil is  the  aperture in  centre of  the  iris diaphragm that regulates entry  of  light into the eye. Colour of  pupil  is  said  to be  black. Actu

What is Biochemical Composition As life evolved on this planet, nature selected only a few elements, and life eventually came to be based essentially on carbon compounds. Out o

Risk Assessment of Biological Hazards Biological hazards of concern to public health include pathogenic strains of bacteria, viruses, helminths, protozoa, algae and certain tox

The Physical Environment   The actual hospital environment is another factor that may be stressful for the child and family. There are many unfamiliar sights, sounds and smells

Q. Anatomic Factors in Patient Selection for Mitral Valvuloplasty ? The ideal patient is young, has pliable non calcified mitral leaflets, and mild subvalvular disease. TEE may

Oxidative phosphorylation Oxidative phosphorylation is a metabolic pathway which uses energy released through the oxidation of nutrients to generate adenosine triphosphate (ATP

Silver point extended below canal orifice: - This discrepancy between the round silver wire and an irregularly shaped canal provides the clinician with an opportunity to use so

Q. What are the four groups of protozoans? The four main groups of protozoans are the mastigophores flagellated, like the trypanosome that causes Chagas' disease, the sarcodine