Sequence for the beta actin gene, Biology

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning

Posted Date: 3/23/2013 2:04:13 AM | Location : United States







Related Discussions:- Sequence for the beta actin gene, Assignment Help, Ask Question on Sequence for the beta actin gene, Get Answer, Expert's Help, Sequence for the beta actin gene Discussions

Write discussion on Sequence for the beta actin gene
Your posts are moderated
Related Questions
how would one determine that the wild type phenotype of a certain trait is due to the action of one or two genes?

Q. What is ascaris? What is the disease caused by this worm? Ascaris lumbricoides or Ascaris is an animal of the nematode phylum that is a roundworm. Ascaris causes ascariasis,

What is Subphylum Crustacea and Subphylum Uniramia? The Arthropoda are usually grouped into four subgroupings called subphyla (singular-subphylum). One of these four subphyla -

Q. What are taenias? What are the diseases caused by them? The Taenias, as well know as tapeworms, are platyhelminth animals (flatworms). The major diseases caused by taenias a

#White blood cell has mainly 5 types right? which is Neutrophil,Monocytes,lymphocytes, basophil and Eosinophil? I wwanted to know is phagocytes a white blood cell, if yes then why

Q. Study of food texture? We learnt earlier that texture is observed in terms of tactile sensations i.e. finger feel and mouth feel. Finger feel is sensed before ingestion, by

What are the etiological agents of malaria? The etiological agents of malaria are protozoans of the genus Plasmodium. There are four dissimilar types of plasmodia that cause ma

What is the difference between transcription and translation? Transcription is the name given to the formation of RNA molecules from an open DNA chain used as a template. Trans

Q. Etiologic factor of ulcerative colitis? No single etiologic factor has been identified although genetic auto-immune factors are thought to be involved. Although exacerbation

Abrasive action of water, ice and wind Water is an important mechanical weathering agent both in liquid as well as in the frozen state.  Rain water carrying sediments, ice glac