Sequence for the beta actin gene, Biology

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning

Posted Date: 3/23/2013 2:04:13 AM | Location : United States







Related Discussions:- Sequence for the beta actin gene, Assignment Help, Ask Question on Sequence for the beta actin gene, Get Answer, Expert's Help, Sequence for the beta actin gene Discussions

Write discussion on Sequence for the beta actin gene
Your posts are moderated
Related Questions
What is meant by the law of use and disuse and by the law of the transmission of acquired characteristics? As per to the law of use and disuse the characteristics of a body var

Initiation of Development - Development Biology We know that the various events collectively called the activation programme. These events are directly related to the formatio

What is Thermoregulation in Cold? Heat production parallels the increase in O 2 uptake, the magnitude of which depends on the muscle mass .engaged in slivering or work and the

Define Sample Preparation for Haemoglobin Content in Blood Wipe the index finger or middle finger with a cotton swab soaked in spirit. Prick the finger with a lancet op

An mRNA molecule codifies only one type of protein? Eukaryotic cells have monocistronic mRNA, i.e., every mRNA codifies only one polypeptide chain. Prokaryotes can present poly

Explain Deformaties of the Cliest wall should be Noted a) Pectus carinatum (pigeon chest): may be associated with Marfan syndrome. b) Pectus excavatum: commonly seen in Marfan

Multicausal Nature of Cancer With several dividing cells in the organism and the various proto-oncogenes and tumor suppressor genes that can be changed to cause cancer. one m

Determine about the Soil and its importance Everyone knows about soil as a resource which fulfils the basic requirement of human kind by supporting variety of plants and other

Types of cells in Phloem The phloem consists of 4 types of cells: i).sieve elements, ii) companion cells, iii) phloem parenchyma and sometimes iv) phloem fibres. The metabolit

Define Management of Parkinson's Disease - Drug, Feeding and Nutritional Care? There is no cure yet for Parkinson's disease, but its symptoms can be minimized with drug thera