Sequence for the beta actin gene, Biology

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning

Posted Date: 3/23/2013 2:04:13 AM | Location : United States







Related Discussions:- Sequence for the beta actin gene, Assignment Help, Ask Question on Sequence for the beta actin gene, Get Answer, Expert's Help, Sequence for the beta actin gene Discussions

Write discussion on Sequence for the beta actin gene
Your posts are moderated
Related Questions
Conservation of biodiversity is very important to maintain the ecological balance of ecosystem. Various steps for conservation of biodiversity: 1.           Creation of consc

I need the parts of the structure carbon. Include elements,monomer,polymer, and any sub units

Q. Dietary management of dyspepsia? Keeping in mind the etiology, symptoms and complications of dyspepsia it must be clear that treatment and management of [his disorder does n

Explain Sexual Reproduction ? In most higher organisms, replication occurs by sexual reproduction. Sexual reproduction begins with a process called meiosis. The products of me

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Weaning the Infant from the Incubator When heater output reading is minimal or nil it suggest that infant is capable of generating enough metabolic heat to keep himself war

Explain the Decolourizing Agent - Stain Technique? 95% ethanol is used as a decolourizing agent. It has two functions - (1) It acts as protein - dehydrating agent, and (2

how does a plasma membrane regulate movement of molecules into and out of a cell? is it polarity, integrity, permeability, or solubility? these are my choices

What are the main events of the final mitotic period? The final mitotic phase is telophase. In telophase the following events happens: decondensation of chromosomes, every set

Define the Prevention of Adverse Food Reactions? Considering the increasing incidence, cost and morbidity associated with allergic reactions, it is perhaps useful to design pre