Sequence for the beta actin gene, Biology

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning

Posted Date: 3/23/2013 2:04:13 AM | Location : United States







Related Discussions:- Sequence for the beta actin gene, Assignment Help, Ask Question on Sequence for the beta actin gene, Get Answer, Expert's Help, Sequence for the beta actin gene Discussions

Write discussion on Sequence for the beta actin gene
Your posts are moderated
Related Questions
What is an antigen? Antigen is any substance, particle or infectious agent known as foreign to the body. The contact of the antigen with the body promotes a defense reaction ag

Q. How is the ovulation date estimated with the control of the woman's body temperature? One method to estimate the exact ovulation day is daily control of the body temperature

Q. Explain Therapy for diarrhoea? The therapy for diarrhoea thus consists of: 1. Determining the status of dehydration 2. Fluid management * Oral Rehydration Therapy (

Define some Precautions for Measurement of pH? 1. Never touch the membrane of the glass electrode with anything else except soft tissue paper since it is fragile and is easily


Given four respiratory capacities (a - d) and four jumbled respiratory volumes of a normal human adult: Respiratory Respiratory capacities volumes. 1.            Residual vol

Why lymph is called the middle man of our body?

Q. What is the lasting form in the gametophyte, pteridophytes or the sporophyte? How can it be compared to bryophytes? The lasting form in pteridophytes is the diploid (2n) spo

The  extracellular   surface  of  the  plasma  membrane   is  frequently  covered  with  a protective  coat  of carbohydrate. A Sugar  residue  of this  carbohydrate  coat can  be

what type of gametes would be produced from genotype AA, Bb, AABb and someone who is heterozygous for 3 traits