Sequence for the beta actin gene, Biology

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning

Posted Date: 3/23/2013 2:04:13 AM | Location : United States







Related Discussions:- Sequence for the beta actin gene, Assignment Help, Ask Question on Sequence for the beta actin gene, Get Answer, Expert's Help, Sequence for the beta actin gene Discussions

Write discussion on Sequence for the beta actin gene
Your posts are moderated
Related Questions
Q. What are the target organs upon which glucagon and insulin act? Glucagon mainly acts upon the liver and Insulin acts generally upon all cells. Both also act upon the adipose

What is produced at the end of the cell cycle? how do they compare to each other and to the parent cell? What happens to the parent cell?

Wildlife - Ecology The term wildlife probably originated in 1913 in a book, Our Vanishing Wildlife by William Hornaday, Director of the New York Zoological Park. The main focu

Q. What is severity of the oesophagitis? The severity of the oesophagitis resulting from oesophageal reflux is determined by the content of gastric reflux mucosal resistance,

Explain exotic species? Describe with the help of two examples how the exotic species disturb the native species of an ecosystem ?

Define Fluconazole It is a weaker inhibitor of CYP3A4 than itraconazole or ketoconazole but may still increase serum concentrations of drugs metabolized by 3A4, like cyclospor

Looking at what the academic world is publishing, microarray research is actually hot right now, and people haven't quite figured out what the best way is (some might argue if we s

When underlying coronary artery disease is the cause of heart failure in the coronary revascularization may both improve symptoms and prevent  progression. Patients with angina and

SIMPL E EPITHELIA (UNILAYERED EPITHELIA) - 1 .      SIMPLE SQUAMOUS EPITHELIUM (PAVEMENT EPITHELIUM) - It is composed of large flat cells whose edges fit closely toge

How you can Repair Ventricular Aneurysm with a patch? Repair of Ventricular Aneurysm with a patch :  Originally described by Cooley, as endoaneurysmorra