Sequence for the beta actin gene, Biology

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning

Posted Date: 3/23/2013 2:04:13 AM | Location : United States







Related Discussions:- Sequence for the beta actin gene, Assignment Help, Ask Question on Sequence for the beta actin gene, Get Answer, Expert's Help, Sequence for the beta actin gene Discussions

Write discussion on Sequence for the beta actin gene
Your posts are moderated
Related Questions
Q. What are alkalosis and acidosis? Acidosis is the condition in which the blood pH is abnormally low Alkalosis is the condition in which the blood pH is abnormally high Normal

Describe Arteriovenous Continuous Murmur? Arteriovenous Continuous Murmur :  These can be congenital as in coronary artery fistula entering RA/RV/PA, sinus of valsalva to rig

Empiric Initial Therapy  Until susceptibility results are available, empiric initial treatment consists of a 4-drug regimen of isoniazid, rifampin, pyrazinamide and ethambutol.

Q. How many cellular nuclei does the pollen tube of angiosperms have? What is ploidy of each of these nuclei? The pollen tube explicitly the mature male gametophyte of angiospe

Forms of Soil Water Gravitational Water or Ground Water: After a heavy rain or irrigation, much of the water drains or sinks downwards. This is called gravitational water.

Arrayed library: An individual primary recombinant clones (hosted in the phage, cosmid, YAC, or other vector) which are placed in two- dimensional arrays in microtiter dishes. Eac

It is defined as the amount of heat liberated when one unit mass of fuel is burnt and the products of combustion are allowed to escape.                                  LCV = HC

ALCOHOLISM - Continual heavy consuming of alcohol is called alcoholism or drinking . Word alcohol is refered to C 2 H 5 OH or ethyl alcohol or ethanol or grain alcohol.

HlSTORY OF PSYCHIATRY: The earliest treatment of  mental disorders was practiced by stone age cave dwellers. For certain mental disorders,  the early Shaman or medicine man, t

Q. How Implant design and surface affect osseointegration? Implant design Most conductive design for osseointegration is root form. They can be threaded, hydroxyapatite co