Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Why do vestigial structures persist in modern organisms? Explain the evidence that indicates that species evolve over time. The environment will not select for or against
Explain the Disadvantages of Colonies Obtained At Different Dilution 1. Heat sensitive microorganisms may be damaged by melted agar, giving low viable count as compared to spre
Out of 67,410 randomly selected surgeries tracked in a study in the UK, 2832 were followed by surgical site infections. a. What is the best estimate of the probability of an
How do I write the expression for reaction rate (transport) of species between the arterial compartment and the other tissue compartments in symbiology?
Q. What are the functions of pantothenic and biotin acid for the body? How are these vitamins obtained? Biotin also known as vitamin B8 is a vitamin that acts in the metabolism
Which one of the following statements about all the four of Spongilla, Leech, Dolphin and Penguin is correct? 1. Penguin is homiothermic while the remaining three are poikilothe
Schizocoelous pattern – Coelom There are two patterns of coelom formation in animals schizocoelous and enterocoelous. In schizocoelous pattern, two teloblasts cells (primordi
What are the special considerations required to be taken in maintenance of implants? The procedures for maintenance of patients with implants are similar to those with natural
assignment on the topic proteins
Venous Thromboembolism Prolonged immobilization (>8 hours) increases the risk of lower extremity deep vein thrombosis (DVT), particularly in travelers with risk factors for th
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd