Sequence for the beta actin gene, Biology

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning

Posted Date: 3/23/2013 2:04:13 AM | Location : United States







Related Discussions:- Sequence for the beta actin gene, Assignment Help, Ask Question on Sequence for the beta actin gene, Get Answer, Expert's Help, Sequence for the beta actin gene Discussions

Write discussion on Sequence for the beta actin gene
Your posts are moderated
Related Questions
Q. What is nidation? In which phase of the menstrual cycle does nidation occur? Nidation is the implantantion of the embryo in the uterus and Nidation takes place around the 7t

Biodynamic: This dealing with energetic of organisms. Biodynamic is a method of organic farming which treats farms as unified or individual organisms, emphasizing balancing the ho

explain the relationship between concentration gradient and active and passive transport

What is plutonium reprocessing? Why is it a big environmental issue? Plutonium is the highly radioactive chemical element produced from uranium by nuclear plants. Plutonium can

A recently married man and woman discover that each had an uncle with alkaptonuria, otherwise known as "black urine disease," a rare disease caused by an auto somal recessive allel

Shortness of Breath It is a subjective sensation of being unable too draw in enough air to breathe. Most often, this is associated with congestive cardiac failure and may

What is Ground Meristem in primary growing shoot? The ground meristem produces new cells which ultimately develop into parenchyma cells. The central portion of the primary shoo

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Molecular Biology - transgenesis Difficult to successfully insert the gene then successfully re-implant embryo possible pleiotropic effects low success rate / tak

Counseling is a process whereby a qualified person purposefully assists another person to handle his or her problems. Counselling is not just giving advice. It is dependent  on mut