Sequence for the beta actin gene, Biology

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning

Posted Date: 3/23/2013 2:04:13 AM | Location : United States







Related Discussions:- Sequence for the beta actin gene, Assignment Help, Ask Question on Sequence for the beta actin gene, Get Answer, Expert's Help, Sequence for the beta actin gene Discussions

Write discussion on Sequence for the beta actin gene
Your posts are moderated
Related Questions
Explain the term active transport? Active Transport :  At intervals, protein assemblies involved in selective, or active transport of materials are inserted into the cell mem


Explain Post Myocardial Infarction Surgery Indications ? Indications for Surgery :  Presence of ventricular septal rupture is an indication for surgery. Timing of surgery is


Explain Adverse effects of Emtricitabine  Emtricitabine can cause hyperpigmentation of the palms and soles, particularly in dark-skinned patients. Because emtricitabine is also

If a tissue was heated to 65ºC for 10 minutes, respiration would cease even if oxygen and food were supplied. Why is this? A temperature of 65°C for 10 minutes would denature

What is the difference between ulcerative colitis and Crohn's disease? The differences between the two include: I) Anatomic distribution of the inflammatory process: Crohn'

Clothes : The concept of clothes might have started even before weaving, as an extension of  the practice of carrying food hd  implements about.  Attachments with a convenient

Illustrate the name of surgical needle The surgical needle is comprised of 3 parts: the needle point, the needle body, and the swaged (press-fit) end. Needle may be broadl

Define the Drugs Effects on Excretion? Use of certain drugs can influence the excretion of certain substances. For example, besides their intended increase in sodium excretion,