Primary egg envelopes, Biology

Assignment Help:

Primary Egg Envelopes

These are the egg envelopes which develop in the ovary between oocyte and follicle cells in the space occupied by the interdigitating microvilli. Such envelopes have been named variously in different animals.

a) It is named as vitelline envelope or vitelline membrane in insects, molluscs, amphibians and birds.

b) In tunicates and fishes, it is known as chorion. In many sharks and bony fishes the primary envelope has striated appearance and is referred to as zona radiata representing the degraded microvilli of the growing oocyte. The perforation in the zona radiata becomes the micropyle through which the spermatozoa can enter the egg.

c) In mammals, the unstriated and modified zona pellucida is formed as a result of joint efforts of egg and follicle cells. While escaping the Graafian follicle mammalian oocyte carries on the surface of zona pellucida a layer of follicle cells known as corona radiata. The primary envelopes usually stick closely to the egg surface. These later on participate in the formation of fertilization membrane.


Related Discussions:- Primary egg envelopes

Respiration, different type of respiration in animals

different type of respiration in animals

Human respiratory system - thoracic cavity, THORACI C CAVITY - Thor...

THORACI C CAVITY - Thoracic cavity is air tight. On dorsal side vertebral column present. On ventral side sternum present. On lateral side 12 pairs ribs present. On p

What is the futile cycle, What is the futile cycle The futile cycle is ...

What is the futile cycle The futile cycle is avoided because covalent modification, by  phosphorylation, has opposite effects on  the  enzymes concerned with  the  synthesis  a

Theory of embryology - theory of pangenesis, THEO R Y OF PANGENESIS - ...

THEO R Y OF PANGENESIS - Proposed by Charles Darwin. According this miniature present in the every body cell i.e. called gemmule

Disorders of liver, DISORDERS OF LIVER: In the foregoing  sections and...

DISORDERS OF LIVER: In the foregoing  sections and sub-sections we have discussed about the common disorders of upper and lower gastrointestinal  tract. Now we shall discuss

Why influenza activity is mandatory in the united states, Healthcare provid...

Healthcare provider reporting of influenza activity is mandatory in the United States.

What are intraspecific ecological interactions, What are intraspecific and ...

What are intraspecific and interspecific ecological interactions? Intraspecific ecological interactions are those among individuals of the same species. Interspecific ecologic

Is there a exchange of cells between the mother, Is there a exchange of cel...

Is there a exchange of cells between the mother and the fetus through the placenta? Under normal conditions, there is not a passage of cells across the placenta during gestati

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain the precautions for sub-culturing of a culture, Explain the Precaut...

Explain the Precautions for Sub-Culturing of a Culture 1. Sterilization of inoculating wire before and after the transfer is a must. Sterilized wire should not be kept on labor

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd