Plasmid, Biology

Plasmid is the class of the circular, extrachromosomal, autonomously replicating, DNA elements found in number of bacteria. Contain origins of the replication to ensure their maintenance. Some of the plasmids are capable of integrating into host genome. A number of artificially constructed plasmids are used as the cloning vectors or to change the characteristics of the bacteria. The common plasmids known are pBR322, pGEM, pUC18. 

Posted Date: 8/3/2012 6:56:29 AM | Location : United States







Related Discussions:- Plasmid, Assignment Help, Ask Question on Plasmid, Get Answer, Expert's Help, Plasmid Discussions

Write discussion on Plasmid
Your posts are moderated
Related Questions
Patients Not on HAART For HIV-infected patients requiring TB treatment who are not currently being treated with highly active antiretroviral therapy (HAART), it may be prudent

A typical chest x-ray exposes the patient to a radiation dose of 0.01 rem. If a man receives 10 such x-rays in a lifetime, what is his chance of developing cancer as a result of th

Explain Control of Oedema in Nutritional Care? Low levels of circulating proteins lead to oedema due to loss of colloidal osmotic pressure to maintain the normal fluid shift me

What are autotrophic beings? What are heterotrophic beings? Autotrophic beings are those that can make their own food, i.e., that make organic material from inorganic compound

The following progeny genotypes were observed: 73 AaBb, 64 aabb, 279 Aabb, 303 aaBb. Using a chi-square test, test whether these two loci show independent assortment? How would

PHOSPHOLIPIDS Most abundant lipid present in cell membrane, also called membrane lipid. It is made up of lipid & phosphoric acid. The basic phospholipid is phosphat

Describe the difference between dna and protein. (structural unit, linkage bond, primary and spatial structure)


Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain about the Paediatric and Geriatric Nutrition? Every stage has its unique requirements due to different changing needs. Adequate and optimum nutrition support is very im