Opiate narcotics - psychological drug dependence, Biology

OPIATE NARCOTICS -

  • They suppress brain activity and relieve pain popularly known as pain killers.
  • They are sedative and astringent in nature.
  • An astringent causes contraction of a tissue, arrest of secretion or control of bleeding.
  • These narcotics are opiates or opiods.
Posted Date: 10/4/2012 8:28:22 AM | Location : United States







Related Discussions:- Opiate narcotics - psychological drug dependence, Assignment Help, Ask Question on Opiate narcotics - psychological drug dependence, Get Answer, Expert's Help, Opiate narcotics - psychological drug dependence Discussions

Write discussion on Opiate narcotics - psychological drug dependence
Your posts are moderated
Related Questions
formulation of RDA

Class Holothuroidea Body cucumber-such as; no arms; no spines; no pedicellariae; ossicles minute and embedded in muscular wall; anus present; tube feet along with suckers; am

Which of the following best describes the tenants of Pangenesis Theory? A. The hereditary material is composed in every organ/tissue and is transmitted to the next generation b

What are the major gas exchange organs of the plants? How is the procedure accomplished? In covering of the leaves and of the primary structure of the stem gas exchange is made

Define kinds of plants and animal on earth - Taxonomy? Taxonomic studies have major objective-the learning of the kinds of plants and animal on earth, their names, their distin

What are steroids? What are some examples of steroids with a biological function? Steroids are lipids based in an angular combination of four carbon rings, three of them made o

Differences between cells of Prokaryotes and Eukaryotes The prokaryotes also differ from the eukaryotes in many other ways, as you can see from Table. Table: Differences

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Q. Pathophysiology of aortic regurgitation? Left ventricle responds to chronic aortic regurgitation by chamber dilatation and an increase in its compliance so that end diastoli

From an ecological point of view, species richness alone has limited value. More meaningful measures use the number of different species in a given area (species richness) as well