Life cycle of malarial parasite, Biology

Life cycle of malarial parasite
  1. When the mosquito sucks the blood, gametocytes enter its digestive system.
  2. They migrate into the walls of the digestive system and undergo further development.
  3. Macrogametocyte develops into macrogamete, which is equivalent to unfertilised ovum.
  4. Microgametocyte divides further and gives rise to microgametes, which are equivalent to sperms.
  5. These two gametes fuse to give rise to zygote.
  6. The zygote migrates to the outer layers of the wall.
  7. It grows in size and divides to produce large number of sporozoits. The sporozoits migrate to the salivary glands of mosquito and reside in the tubules.
  8. When the infected mosquito bites, the sporozoits enter the human body along with the saliva of mosquito. This part of life cycle is the sexual cycle because it undergoes sexual reproduction in the body of mosquito.

354_life cycle of malarial parasite.png

Posted Date: 8/29/2012 7:36:38 AM | Location : United States







Related Discussions:- Life cycle of malarial parasite, Assignment Help, Ask Question on Life cycle of malarial parasite, Get Answer, Expert's Help, Life cycle of malarial parasite Discussions

Write discussion on Life cycle of malarial parasite
Your posts are moderated
Related Questions
Q. Risk Factors for GDM? If any of the following risk factors are present in a woman, she may develop GDM: 1) Presence of obesity. 2) If any family members (parents, brot

Q. What do you mean by Primary Metabolites ? As the name indicates, primary metabolites are molecules involved in vital metabolic pathways. They are of universal occurrence and

Kinds of Matter On basis of its chemical organization, matter id of three categories elements, compounds and mixture An element is composed of obviously, earth similar atoms

Explain Cardiopulmonary Resuscitation? The heart rhythm associated with cardiac arrest can be either ventricular fibrillation/ ventricular tachycardia (VT/VF) or other rhythms


Explain briefly how computed tomography (CT) helps the doctors in pinpointing the defects in the patient's body

You have a neuron with a resting potential of -55 mV, EK of -70 mV, and ENa of 50 mV. You decide to voltage clamp the neuron. Now, draw the membrane current over time. What will th

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Q. Is monoculture a system that contributes to great biological diversity of an ecosystem? The Monoculture implies that in a large area a single crop (only one species of plant

discuss about protozoa,metazoa,mesozoa and parazoa