Implementation of nursing care for thalassemia patient, Biology

Implementation of Nursing Care 

Prepare the Patient for Diagnostic Evaluation

Your role as a nurse is to provide continuing support to the child and family during diagnostic studies and prepare the child both physically as well as psychologically  for such studies. 

Administration  of Transfusion Therapy

Children who cannot maintain a haemoglobin level of about 7 mg/dl receive regular transfusion tharapy to prevent chronic hypoxemia and  to suppress ineffective erythropoisis. Frozen RBC packed cells less than a week old should be used. Prevent and watch for transfusion reactions. Regulate the rate so as to prevent volume over  load or cardiac failure. 

Nursing Care During Blood Transfusion 

  1. Your first responsibility is to identify donor and recipient blood types and groups on lables and patient's charts. Ensure that blood is administered slowly. 
  2. Check the intravenous site frequently for infiltration. Observe the patient for transfusion reactions which include, chills, itching, rash, fever, headache and pain in the back or other parts or body. 
  3. Clamp off the tubing immediately if such rection occurs in the patient and report to your senior. You should not remove the needle unless you are specifically instructed to do the same. 
  4. Maintain the patency of  tube by opening the saline line if blood has been stopped. This will ensure administration of neccessary medications and preservation of vein for further infusions. 
  5. Always use infusion pump to regulate flow of blood or fluid to prevent the danger of circulatory over load in children. 
  6. Watch for complication which include, dyspnoea precordial pain and distended neck veins. There can also be a danger of air emboli or electrolyte disturbance. So you need to be alert particularly in case of a child who needs repeated transfusion. 
  7. You should save the blood bag and  tubing if  the transfusion reaction occurs and return the same to blood bank depending upon the policy and routine of  your hospital. Mostly the reaction occurs within first 10 minutes of administration, but you should carefully watch the child  thoughout the treatment. 
  8. You  have to administer drugs such as Benadryl for allergic reaction, and aminophylline for wheezing if  they are prescribed by concerned physician. 
  9. Always prewarm the blood to be administered to prevent cardiac arrhythmias. 
  10. You should always monitor vital signs, temperature, pulse, respiration and blood pressure before transfusion and monitor changes.  
Posted Date: 10/26/2012 9:27:09 AM | Location : United States







Related Discussions:- Implementation of nursing care for thalassemia patient, Assignment Help, Ask Question on Implementation of nursing care for thalassemia patient, Get Answer, Expert's Help, Implementation of nursing care for thalassemia patient Discussions

Write discussion on Implementation of nursing care for thalassemia patient
Your posts are moderated
Related Questions
What does a two-direction arrow show in a chemical equation? The oxygen atoms share two pairs of electrons, as every atom needs two more electrons to fill the orbitals of its o

What raw materials require for the manufacture of margarine Soybean and peanut (or groundnut) oils are of great economic importance. Refined soybean oil contains branched fura

Swine-pox Pigs of 2 months of age may be infected with vaccinia either naturally or artificially and show pox lesions on the eyelids, snot, inside the thigh and undersurface of th

Why do ribosomes move along mRNA during translation? During translation the ribosome always exposes two mRNA codons to be translated by moving along the mRNA. When a peptide bo

Recovery of tar: the coke oven gas coming out from ovens is passed through a tower where liquid ammonia is sprayed. The tar and dust are removed and then recovered. Recover of

What is cell biology? Cell biology is the science of studying how cells function like as their reproduction and metabolism, their internal and external anatomy.

The human skeleton has evolved from that of four-legged animals. Unfortunately, the adaptation is far from perfect; thus, our upright posture causes problems like back age and the

OFF PUMP SURGERY :  In spite of great advancements in techniques of cardio pulmonary bypass, it is still not physiological. There can be various complications related to perfusion

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Scaling Instrumentation of prothesis Although stainless steel is generally the most effective material for removing calculus, it cannot be used with implants, because it scratc