Illustrate homologous chromosomes, Biology

Assignment Help:

Q. In which period of meiosis does the pairing of homologous chromosomes occur?

The pairing of homologous chromosomes is a very important step for meiosis because the rightness of the homologous separation depends on the process this event occurs in prophase I of the cell division.


Related Discussions:- Illustrate homologous chromosomes

Classification of viruses, Classification of Viruses No evolutionary or...

Classification of Viruses No evolutionary or phylogenetic exist between viruses. A   nature system of classification cannot, therefore, be devised for viruses. Holmes (1948)

Phytoplankton stage - hydrarch, Phytoplankton Stage - Hydrarch In this...

Phytoplankton Stage - Hydrarch In this initial stage, the pond water is poor in nutrients and is devoid of much life. At this stage, the water is incapable of supporting large

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain biochemical mediators of calcium metabolism, Explain biochemical me...

Explain biochemical mediators of calcium metabolism Bone physiology is controlled by an interaction of mechanical and metabolic factors. Under physiologic circumstances, bone

What is panoramic x-ray, What is Panoramic X-Ray This is one of the mos...

What is Panoramic X-Ray This is one of the most vital radiological techniques in planning placement of dental implants. Not only will it give you the complete picture of the pe

What are the destinations of those oxygen atoms, Q. Photosynthesis is the m...

Q. Photosynthesis is the most significant producer of molecular oxygen (O2) on our planet. From which molecule do oxygen atoms liberated by photosynthesis come and from which other

Explain diffusion and osmosis in cell structure, Explain Diffusion and Osmo...

Explain Diffusion and Osmosis in cell structure? Diffusion and Osmosis :  Diffusion through a cell membrane occurs as it does elsewhere, from an area of high concentration of

What are toxic effects of lectins or haemagglutinins, What are toxic effect...

What are toxic effects of lectins or haemagglutinins? Well, these can cause growth inhibition in animals and diarrhoea, nausea, bloating and vomiting in case of human beings. W

Why superoxide radical scavenging of beverages, Why is Superoxide radical s...

Why is Superoxide radical scavenging of beverages such red wine, grape juice measured at 560 nm?

Describe about cardiomyopathy due to persistent tachycardia, Q. Describe ab...

Q. Describe about Cardiomyopathy due to Persistent Tachycardia? In occasional cases, particularly in children recurrent or incessant episodes of supraventricular or ventricular

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd