Germ line gene therapy, Biology

Germ line gene therapy - This approach either targets to correct the totipotent cells within human conceptus or stimulate the genetic modifications within reproductive cells that is gametes (sperms or eggs) (Elias and Annas, N.D). It produces permanent and irreversible results which get transmitted to the future generations. A fertilized egg develops into an embryo from which all the cells of the body originate. Hence a correction of genetic errors introduced during the early stages of embryogenesis gets transmitted to every cell of the offspring. This approach is more effective in comparison to somatic gene therapy as it produces long lasting effects throughout the body (Henry, N.D). This approach is also used during creation of transgenic animals. The ultimate target of this approach is to eradicate certain genetic disorders from a particular family or population as a whole. As the effects of this therapy get deliberately passed to future generation unlike other medical interventions, the practical application of this therapy within human beings is under debate(Elias and Annas, N.D). People who stand against this therapy fear that it may alter the gene pool, lead to social dangers or increase the chances of possible clinical risks (Elias and Annas, N.D).

 

Posted Date: 8/9/2012 6:33:27 AM | Location : United States







Related Discussions:- Germ line gene therapy, Assignment Help, Ask Question on Germ line gene therapy, Get Answer, Expert's Help, Germ line gene therapy Discussions

Write discussion on Germ line gene therapy
Your posts are moderated
Related Questions
What are the Materials required for Radiographic 1. Alginate impression material. 2. Silicone separating spray/ petroleum jelly 3. Autopolymerizing PMMA (Clear)

Q. Bone Loss - criteria for endosteal implants? Crestal bone loss after intial healing is a primary indicator of the need for initial preventive therapy. Early loss of crestal

What is the difference between spermatids and sperm cells? What is the name of the transformation of spermatids into sperm cells? Sperm cells (the male gametes) are matured spe

Why can it be said that a recessive allele can remain hidden in the phenotype of an individual and revealed only when manifested in homozygosity in the offspring? A recessive a

Gas Exchange Gill surface area must be large enough to provide adequate exchange of gases. Therefore, highly active fish have largest relative gill area. Figure compares highl

Explain Transposition with VSD and Pulmonary Stenosis ? In the early years Rastelli and le Compte operations had 20 to 30 per cent mortality. This has been reduced to 5 per c

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Q. How respiratory pigments act? Respiratory pigments are oxygen-carrying molecules present in the blood. When the oxygen concentration is high for instance, in the pulmonary a

In f e c tiou s Diseases Infectious diseases inflicts major economic losses as the disease spreads from one animal to other and large number of animals are affected with t

Explain holding method of pasteurization In the holding method of pasteurization (62 o C for 30 minutes) or the high-temperature short-time (HTST), 71 o C for 15 minutes method