External ear, Biology

EXTERNAL EAR -

  1. It is an oval shaped, some what funnel like, skin covered flap of elastic cartilage and muscles.
  2. It's outer stiff ridge is called hellix. Lower flexible lobe is lobule. Cavity is known as auricle or Concha.
  3. It collects sound waves and direct them to canal i.e. external auditory meatus.
  4. It is trumpet shaped in rabbit. Situated on lateral side of head part.
  5. Immovable as oticularis muscles are vestigeal, movable in rabbit.
  6. External auditory meatus run up to tympanum. It is 'S' shaped tube to prevent hard objects hitting the tympanum directly, in rabbit tube is long & straight.
  7. Canal is supported by elastic cartilage in the outer portion & by temporal bone in the inner portion.
  8. Outer region of canal bears hair to cheek dust particle.
  9. Inner region consists of ceruminous gland or wax gland to secreate cerumen or ear wax to protect lining of meatus & tympanum.
  10. Pinnae absent in platypus, whales seal, walrus & sea cow etc.
  11. Tympanum or tympanic membrane is thin, oval, tightly stretched on a cartilage i.e. Annular tympanicus.
  12. It is composed of connective tissue with fibres radiating from the central region called umbo.
  13. It's external part is ectodermal, middle part is mesodermal & inner part is endodermal in origin.

2348_man ear structure.png

Ear of Man

742_rabbit ear.png

Ear of Rabbit

Posted Date: 10/3/2012 2:42:33 AM | Location : United States







Related Discussions:- External ear, Assignment Help, Ask Question on External ear, Get Answer, Expert's Help, External ear Discussions

Write discussion on External ear
Your posts are moderated
Related Questions
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Biodiversity maintains the air we breathe and the water we drink. Green plants purify our air and our water by taking in carbon dioxide, regulating water vapour, releasing oxygen,

Q. What is the functional unity of the kidneys? The functional (filtering) unity of the kidneys is the nephron a nephron is made of efferent arteriole, afferent arteriole, glom

Question 1 Write a short note on the following- Plasmids Retrotransposons Hfr Conjugation Generalized transduction Question 2 With the help of a neat diagra

How is the ovulation date estimated with the control of the woman's body temperature? One method to estimate the exact ovulation day is daily control of the body temperature ta

Caryopsis - Development of Fruit In cereals each carpel has one ovule and therefore the mature fruit has, just one seed. During maturation, very little or no cell divisions ar

Class Gastropoda Body asymmetrical, depicts torsion or its effects; shell coiled in most, well developed head with radula, large flat foot, gills one or two or with pulmonary

Antibodies Antibodies are important.tools for detecting and localising specific molecules in the cells due to their high specificity. The first requirement for this is to produ

weberian oscles found in

Diagrammatic representation of Implant placement Implant placementIt is located directly apical to the tooth it is replacing and not in an embrasure space. The angulati