Explain why meat products causes diabetics, Biology

Explain why Meat products causes diabetics

Diabetics can have meat products in case they eat non-vegetarian food. Baking, roasting or grilling is preferable to frying. Patient can eat fish and chicken, tell them to remove the skin of chicken as it has more fat. Vegetarian should eat alternative food items rich in protein.

Related Discussions:- Explain why meat products causes diabetics

Mollusca, An account of characters of mollusca

An account of characters of mollusca

Explain food applications of dextran, Food Applications Dextran can be ...

Food Applications Dextran can be used in food products, as it is capable of moisture retention and inhibition of crystallization of sugar. The properties of dextran as gelling

Cardiac care on admission for operation, Cardiac Care on Admission (First t...

Cardiac Care on Admission (First two hours) ECG is monitored by more than one lead (three to five). Left atrial pressure, arterial BP, central venous pressure, respiration

Explain typical components of a closed circulatory system, What are the typ...

What are the typical components of a closed circulatory system? The typical components of the closed circulatory system are the blood vessels within which blood circulates (vei

Define iron status of the individual, Define Iron Status of the Individual ...

Define Iron Status of the Individual Lastly, iron status of the individual is a floury determinant of how much iron is absorbed. On a mixed diet with some haem iron, the overal

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Determine improper fit at the abutment - implant interface, Improper fit at...

Improper fit at the abutment/- implant interface It is very vital that the fit of the abutment is crosschecked radiographically prior to final delivery of the prosthesis. The m

Illustrating how neuropsychologists evaluate young children, Illustrating h...

Illustrating how neuropsychologists evaluate young preschool children, older children, youngster adults, and elderly adults. The brain is an evolving organ and functions very

Evolution of man, diffrentiate between javaman and peckingman

diffrentiate between javaman and peckingman

What are the two big groups into which cells are classified, What are the t...

What are the two big groups into which cells are classified? Cells can be divided as eukaryotic or prokaryotic. Prokaryotic cell is the cell that without a delimited nucleus

Write Your Message!

Name

Email id

Message

Verfication Code

User Account

All Pages