Explain citric acid cycle, Biology

Assignment Help:

Explain citric acid cycle

In  the citric acid cycle, the oxaloacetate is first condensed with acetyl CoA, and  then regenerated  as  the cycle  is  comp!eted.  But these  reactions  are  not part  of a  closed circle system and  are more similar to  a traffic circle with compounds  entering and leaving  as required. Only a small quantity of  oxaloacetate is needed for  the oxidation of a  large  quantity  of acetyl  CoA,  as  it  is  regenerated. Hence,  oxaloacetate may  be considered to play a catalytic role.  

 


Related Discussions:- Explain citric acid cycle

Epimorphic regeneration, Epimorphic Regeneration In this sort of regen...

Epimorphic Regeneration In this sort of regeneration the lost part is reformed and restored via the growth of a bud or blastema from the remaining part of the organism followe

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Emf, In a neuron with a resting potential of -65 mV, the distribution of wh...

In a neuron with a resting potential of -65 mV, the distribution of which ion across the neuronal membrane represents the greatest potential electromotive force (EMF)? A. Potassiu

Explain subphylum mandibulata, Subphylum Mandibulata Most of them have ...

Subphylum Mandibulata Most of them have three pairs of walking legs, mandibles, compound eyes, antennas, some with wings. There are four classes. Crustacea - aquatic with

What is genomics , We are living in an unprecedented age of biological ...

We are living in an unprecedented age of biological discovery and the application of biological knowledge.   Programmed DNA sequencing delivered, in the year of  2001 over the 2.6

Clinical manifestation of emphysema, Clinical Manifestation   Early on...

Clinical Manifestation   Early onset of dyspnea on exertion (DOE) which progresses to continuous dyspnea. Rhonchi, crackles , accessory muscle breathing, Increased rate of br

What is starch , Starch exists in plants as insoluble starch granules in c...

Starch exists in plants as insoluble starch granules in chloroplasts.  Each starch granule   holds   a   combination   of   two   polysaccharide    forms, amylopectin and amylose.

What are the possible effects on the fetus, What are the possible effects o...

What are the possible effects on the fetus if, during pregnancy, the mother (a) smokes, (b) catches rubella?   a) Smoking during pregnancy can lead to an underwe

What are the major biological processes, Q. What are the major biological p...

Q. What are the major biological processes in which calcium participates? Calcium is present in approximately all cells and has various functions. Calcium has an significant ro

How different are cnidarians from poriferans, Concerning tissue complexity ...

Concerning tissue complexity how different are cnidarians from poriferans? Cnidarians have true tissue differentiation, they present separate organized tissues in the body. Por

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd