Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain citric acid cycle
In the citric acid cycle, the oxaloacetate is first condensed with acetyl CoA, and then regenerated as the cycle is comp!eted. But these reactions are not part of a closed circle system and are more similar to a traffic circle with compounds entering and leaving as required. Only a small quantity of oxaloacetate is needed for the oxidation of a large quantity of acetyl CoA, as it is regenerated. Hence, oxaloacetate may be considered to play a catalytic role.
Epimorphic Regeneration In this sort of regeneration the lost part is reformed and restored via the growth of a bud or blastema from the remaining part of the organism followe
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
In a neuron with a resting potential of -65 mV, the distribution of which ion across the neuronal membrane represents the greatest potential electromotive force (EMF)? A. Potassiu
Subphylum Mandibulata Most of them have three pairs of walking legs, mandibles, compound eyes, antennas, some with wings. There are four classes. Crustacea - aquatic with
We are living in an unprecedented age of biological discovery and the application of biological knowledge. Programmed DNA sequencing delivered, in the year of 2001 over the 2.6
Clinical Manifestation Early onset of dyspnea on exertion (DOE) which progresses to continuous dyspnea. Rhonchi, crackles , accessory muscle breathing, Increased rate of br
Starch exists in plants as insoluble starch granules in chloroplasts. Each starch granule holds a combination of two polysaccharide forms, amylopectin and amylose.
What are the possible effects on the fetus if, during pregnancy, the mother (a) smokes, (b) catches rubella? a) Smoking during pregnancy can lead to an underwe
Q. What are the major biological processes in which calcium participates? Calcium is present in approximately all cells and has various functions. Calcium has an significant ro
Concerning tissue complexity how different are cnidarians from poriferans? Cnidarians have true tissue differentiation, they present separate organized tissues in the body. Por
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd