excretory organs, Biology

why the excretory organ of prawn is called ''green gland''?
Posted Date: 6/18/2012 1:48:23 AM | Location : United States







Related Discussions:- excretory organs, Assignment Help, Ask Question on excretory organs, Get Answer, Expert's Help, excretory organs Discussions

Write discussion on excretory organs
Your posts are moderated
Related Questions
write the raspiration of different types of animals of different phylum

What is the vector of malaria? How different is its behavior from the behavior of the vector of dengue fever? The vector of malaria is a mosquito of the genus Anopheles, also k

Enumerate the working of MRI scanner The MRI scanner can be 'tuned' to detect the very subtle disturbances to the magnetic field induced by the different proportions of oxygen

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

How are the proteins important in metabolism of lens? Proteins Physical slate of protein is important for transparency of lens. Morner first time classified protein of l

Phylum Ascomycetes 1) Sexual reproduction is by conjugation and is followed by the formation of ascospores inside a sac called ascus. 2) The asci may be grouped together to

GROWTH AT DIFFERENT LEVELS - 1.      Molecular level - It involves synthesis of new molecules and their aggregation into organellae. 2.      Cellular level - It includes

Define Diarrhoea problem of infants & preschoolers nutrition? We have just covered control and strategies in diarrhoea management in the above section. Crawling, unclean hands,

Define the Future challenges of spatial processes? Understanding the dynamics of stochastic spatial systems, systems with a multitude of spatial scales, and systems along with

Select all of the correct/true answers. The rate of mutation of a given species can be predicted. Mutations are a source of new alleles and contribute to the biodiversity present o