Examine multiple variation parameters for a genomic region , Biology

Assignment Help:
  1. Determine SNP variation among the aligned DNAs for a genomic region.   See below for how to count SNP variation.  The output file (Your_name_snp.txt) should have two columns of numbers.  The first column will indicate total number of SNP sites per species and the second will be the percent of sequences/species having that same number of variant nucleotides.
  2. Determine in-del variation among the aligned DNAs for a genomic region. The output file (Your_name_in_del.txt) should be two columns of numbers.  The first column will indicate total number of in-del sites per species and the second will be the percent of sequences/species having that same number of in-del.
  3. Determine overall variation (SNPs and in-dels) among the aligned DNAs for a genomic region. The output file (Your_name_both.txt) two columns of numbers.  The first column will indicate total number of variant sites (SNP and in-del) per species and the second will be the percent of sequences/species having that same number of variant nucleotides.  This will generate the same data used for the figure on page 3.

Sample Alignment: 48 bases,  differences are highlighted

Seq1      ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Seq2      AAAAATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Seq3      AAAAATGCATGCATGCA-GCATGCATGCATGCATGCATGCATGCATGC

Seq4      AAAAATGCATGCATGCA-GCATGCATGCATTTTTGCATGCATGCATGC

Seq5      AAAAATGCATGCATGCA-GCATGCATGCATTTTTGCAT-CATGCATGC

Computation:  Compare Seq1 to 2,3,4, and 5 you find the differences (SNPs and InDels).

Seq1:Seq1 = 0 changes

Seq1:Seq2 = 3 changes

Seq1:Seq3 = 4 changes

Seq1:Seq4 = 7 changes

Seq1:Seq5 = 8 changes

 Repeat using each of the other sequences as the basis for comparison

Seq2:Seq1 = 3 changes                  Seq3:Seq1 = 4 changes

Seq2:Seq2 = 0 changes                  Seq3:Seq2 = 1 changes

Seq2:Seq3 = 1 changes                  Seq3:Seq3 = 0 changes

Seq2:Seq4 = 4 changes                  Seq3:Seq4 = 3 changes

Seq2:Seq5 = 5 changes                  Seq3:Seq5 = 4 changes

 

Seq4:Seq1 = 7 changes                  Seq5:Seq1 = 8 changes

Seq4:Seq2 = 4 changes                  Seq5:Seq2 = 5 changes

Seq4:Seq3 = 3 changes                  Seq5:Seq3 = 4 changes

Seq4:Seq4 = 0 changes                  Seq5:Seq4 = 1 changes

Seq4:Seq5 = 1 changes                  Seq5:Seq5 = 0 changes

 

Our input file is a FASTA format file of all sequences/species that has been previously aligned and trimmed.  There are some odd characters in the file, so we'll have to deal with that.


Related Discussions:- Examine multiple variation parameters for a genomic region

How low birth weight cause protein energy malnutrition, How Low Birth Weigh...

How Low Birth Weight cause Protein Energy Malnutrition? The beginning of PEM in children starts in US from the time of their birth. At least a third of the Indian children are

What is the formula for photosynthesis, What is the formula for photosynthe...

What is the formula for photosynthesis? H 2 O + 6CO 2 + Light Energy ----> C 6 H 12 O6+ 6O 2 6 molecules of water + 6 molecules of carbon dioxide --->1 molecule of glucose

Enzymes, If a person lying quite still why does he or she need energy for?

If a person lying quite still why does he or she need energy for?

Radiography, RADIOGRAPHY You  have read  in GNM courses about radiographi...

RADIOGRAPHY You  have read  in GNM courses about radiographical examination. In this text the discussion will be on the following radiographical tests.   Chest Roentgenogram

What is the difference between smallpox and measles, Q. What is the differe...

Q. What is the difference between smallpox (variola) and measles? The Smallpox is a viral infection like measles. The Smallpox is transmitted by respiratory secretions, saliva

What is atraumatic needles, What is Atraumatic needles Atraumatic need...

What is Atraumatic needles Atraumatic needles with sutures comprise an eyeless needle attached to a specific length of suture thread. There are several shapes of surgical n

Define broken instrument removal procedures, Define Broken Instrument Remov...

Define Broken Instrument Removal Procedures File or reamer Gates-glidden Peso drills Lentulo spiral paste fillers Thermomechanical gutta-percha computer

What is fixism, What is fixism? Fixism is the theory about the diversit...

What is fixism? Fixism is the theory about the diversity of life on earth that affirms that the current existent species were identical to species of the past and came out alre

Natural organelle''s function would you try to replicate, If you wanted to ...

If you wanted to create a synthetic organelle to test new drugs for toxicity, which natural organelle's function would you try to replicate?

Explain the mechanisms of endosseous integration, Mechanisms Of Endosseous ...

Mechanisms Of Endosseous Integration Three terms may be used to describe individual aspects of bone formation process that can occur around implants. They are Osteoconduction,

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd