Examine multiple variation parameters for a genomic region , Biology

  1. Determine SNP variation among the aligned DNAs for a genomic region.   See below for how to count SNP variation.  The output file (Your_name_snp.txt) should have two columns of numbers.  The first column will indicate total number of SNP sites per species and the second will be the percent of sequences/species having that same number of variant nucleotides.
  2. Determine in-del variation among the aligned DNAs for a genomic region. The output file (Your_name_in_del.txt) should be two columns of numbers.  The first column will indicate total number of in-del sites per species and the second will be the percent of sequences/species having that same number of in-del.
  3. Determine overall variation (SNPs and in-dels) among the aligned DNAs for a genomic region. The output file (Your_name_both.txt) two columns of numbers.  The first column will indicate total number of variant sites (SNP and in-del) per species and the second will be the percent of sequences/species having that same number of variant nucleotides.  This will generate the same data used for the figure on page 3.

Sample Alignment: 48 bases,  differences are highlighted

Seq1      ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Seq2      AAAAATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Seq3      AAAAATGCATGCATGCA-GCATGCATGCATGCATGCATGCATGCATGC

Seq4      AAAAATGCATGCATGCA-GCATGCATGCATTTTTGCATGCATGCATGC

Seq5      AAAAATGCATGCATGCA-GCATGCATGCATTTTTGCAT-CATGCATGC

Computation:  Compare Seq1 to 2,3,4, and 5 you find the differences (SNPs and InDels).

Seq1:Seq1 = 0 changes

Seq1:Seq2 = 3 changes

Seq1:Seq3 = 4 changes

Seq1:Seq4 = 7 changes

Seq1:Seq5 = 8 changes

 Repeat using each of the other sequences as the basis for comparison

Seq2:Seq1 = 3 changes                  Seq3:Seq1 = 4 changes

Seq2:Seq2 = 0 changes                  Seq3:Seq2 = 1 changes

Seq2:Seq3 = 1 changes                  Seq3:Seq3 = 0 changes

Seq2:Seq4 = 4 changes                  Seq3:Seq4 = 3 changes

Seq2:Seq5 = 5 changes                  Seq3:Seq5 = 4 changes

 

Seq4:Seq1 = 7 changes                  Seq5:Seq1 = 8 changes

Seq4:Seq2 = 4 changes                  Seq5:Seq2 = 5 changes

Seq4:Seq3 = 3 changes                  Seq5:Seq3 = 4 changes

Seq4:Seq4 = 0 changes                  Seq5:Seq4 = 1 changes

Seq4:Seq5 = 1 changes                  Seq5:Seq5 = 0 changes

 

Our input file is a FASTA format file of all sequences/species that has been previously aligned and trimmed.  There are some odd characters in the file, so we'll have to deal with that.

Posted Date: 2/25/2013 7:29:13 AM | Location : United States







Related Discussions:- Examine multiple variation parameters for a genomic region , Assignment Help, Ask Question on Examine multiple variation parameters for a genomic region , Get Answer, Expert's Help, Examine multiple variation parameters for a genomic region Discussions

Write discussion on Examine multiple variation parameters for a genomic region
Your posts are moderated
Related Questions
Intracellular sodium concentration of the motor neuron A complete motor neuron is removed from a frog and placed in normal physiological saline at 1 AM.  The neuron is healthy.

Explain about the Proteins? Proteins, as you may already know, are made up of carbon, hydrogen, nitrogen, oxygen and usually sulphur. Proteins are built up of a large number of

Q. Describe the pulmonary artery? The main pulmonary artery is seen on the PA view, as its left border forms the pulmonary bay. The right pulmonary artery runs horizontally to

Q. Principal categories in classification? First of all there is a need to know what classification is? Let us define in simple term. Classification is placing of a plant (or g

Describe the location and structure of the pituitary gland and explain its structural and functional relationships with the hypothalamus.

In the typical Western diet approximately 80-140 G triglyceride and 0.5-1.5 G cholesterol are eaten daily. Following digestion, absorption and reesterification, triglyceride and c

Molybdenum Although molybdenum functions as a component for the enzymes xanthine oxidase, sulfite oxidase and aldehyde oxidase, requirements for it are not established. Molybdenum

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Q. Use of Masks as personal protective equipment? Masks are to be worn when procedures that result in aerosol production are performed. Protection from these masks only affords

What is the histological nature of the glands? How are they formed? The glands are epithelial tissues. They are made of epithelium that throughout the embryonic development inv