Examine multiple variation parameters for a genomic region , Biology

  1. Determine SNP variation among the aligned DNAs for a genomic region.   See below for how to count SNP variation.  The output file (Your_name_snp.txt) should have two columns of numbers.  The first column will indicate total number of SNP sites per species and the second will be the percent of sequences/species having that same number of variant nucleotides.
  2. Determine in-del variation among the aligned DNAs for a genomic region. The output file (Your_name_in_del.txt) should be two columns of numbers.  The first column will indicate total number of in-del sites per species and the second will be the percent of sequences/species having that same number of in-del.
  3. Determine overall variation (SNPs and in-dels) among the aligned DNAs for a genomic region. The output file (Your_name_both.txt) two columns of numbers.  The first column will indicate total number of variant sites (SNP and in-del) per species and the second will be the percent of sequences/species having that same number of variant nucleotides.  This will generate the same data used for the figure on page 3.

Sample Alignment: 48 bases,  differences are highlighted

Seq1      ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Seq2      AAAAATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Seq3      AAAAATGCATGCATGCA-GCATGCATGCATGCATGCATGCATGCATGC

Seq4      AAAAATGCATGCATGCA-GCATGCATGCATTTTTGCATGCATGCATGC

Seq5      AAAAATGCATGCATGCA-GCATGCATGCATTTTTGCAT-CATGCATGC

Computation:  Compare Seq1 to 2,3,4, and 5 you find the differences (SNPs and InDels).

Seq1:Seq1 = 0 changes

Seq1:Seq2 = 3 changes

Seq1:Seq3 = 4 changes

Seq1:Seq4 = 7 changes

Seq1:Seq5 = 8 changes

 Repeat using each of the other sequences as the basis for comparison

Seq2:Seq1 = 3 changes                  Seq3:Seq1 = 4 changes

Seq2:Seq2 = 0 changes                  Seq3:Seq2 = 1 changes

Seq2:Seq3 = 1 changes                  Seq3:Seq3 = 0 changes

Seq2:Seq4 = 4 changes                  Seq3:Seq4 = 3 changes

Seq2:Seq5 = 5 changes                  Seq3:Seq5 = 4 changes

 

Seq4:Seq1 = 7 changes                  Seq5:Seq1 = 8 changes

Seq4:Seq2 = 4 changes                  Seq5:Seq2 = 5 changes

Seq4:Seq3 = 3 changes                  Seq5:Seq3 = 4 changes

Seq4:Seq4 = 0 changes                  Seq5:Seq4 = 1 changes

Seq4:Seq5 = 1 changes                  Seq5:Seq5 = 0 changes

 

Our input file is a FASTA format file of all sequences/species that has been previously aligned and trimmed.  There are some odd characters in the file, so we'll have to deal with that.

Posted Date: 2/25/2013 7:29:13 AM | Location : United States







Related Discussions:- Examine multiple variation parameters for a genomic region , Assignment Help, Ask Question on Examine multiple variation parameters for a genomic region , Get Answer, Expert's Help, Examine multiple variation parameters for a genomic region Discussions

Write discussion on Examine multiple variation parameters for a genomic region
Your posts are moderated
Related Questions
Define Food Behaviour - Public Nutrition? Food is not merely a means to survival but the fuel that drives the human body and the economic engine. What influences what we decide

Ringworm in humans is caused by : 1. Bacteria 2. Fungi 3. Nematodes 4. Viruses Fungi

Binding site  is the place on cellular DNA to which a protein (like transcription factor) can bind. Typically, binding sites may be found in the vicinity of genes, and would be inv

All of the following make meiosis different from mitosis, EXCEPT A. Meiosis comprises two separate divisions. B. Meiosis only occurs during embryonic development. C. Chromosome num

Mitral valve prolapse (MVP) has emerged as a prominent, predisposing structural cardiac abnormality and in adults accounts for 7 to 30 per cent of NVE in cases not related to drug

Determine General Principles of Allergy Management? The four general principles of allergy management include: 1.  Avoid factors that cause symptoms. 2.  Use appropriate

The question asks . . . 18 moles of moles of maltose are completely oxidized by the reactions of the final oxidative pathways (Embden-Myerhoff Pathway and Krebs Cycle). How many AT

AQUATIC ADAPTATION IN ANIMALS

Classification of hydrocolloids by function It must be clear to you now that gum ghatti, gum karaya, gum tragacanth ( classified as exudate gums) locust bean  gum, guar g

Q. To which phase of the plasmodium life cycle do the typical chills and fever of malaria correspond? The typical fever and chills episodes of malaria correspond to the phase w