Examine multiple variation parameters for a genomic region , Biology

  1. Determine SNP variation among the aligned DNAs for a genomic region.   See below for how to count SNP variation.  The output file (Your_name_snp.txt) should have two columns of numbers.  The first column will indicate total number of SNP sites per species and the second will be the percent of sequences/species having that same number of variant nucleotides.
  2. Determine in-del variation among the aligned DNAs for a genomic region. The output file (Your_name_in_del.txt) should be two columns of numbers.  The first column will indicate total number of in-del sites per species and the second will be the percent of sequences/species having that same number of in-del.
  3. Determine overall variation (SNPs and in-dels) among the aligned DNAs for a genomic region. The output file (Your_name_both.txt) two columns of numbers.  The first column will indicate total number of variant sites (SNP and in-del) per species and the second will be the percent of sequences/species having that same number of variant nucleotides.  This will generate the same data used for the figure on page 3.

Sample Alignment: 48 bases,  differences are highlighted

Seq1      ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Seq2      AAAAATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Seq3      AAAAATGCATGCATGCA-GCATGCATGCATGCATGCATGCATGCATGC

Seq4      AAAAATGCATGCATGCA-GCATGCATGCATTTTTGCATGCATGCATGC

Seq5      AAAAATGCATGCATGCA-GCATGCATGCATTTTTGCAT-CATGCATGC

Computation:  Compare Seq1 to 2,3,4, and 5 you find the differences (SNPs and InDels).

Seq1:Seq1 = 0 changes

Seq1:Seq2 = 3 changes

Seq1:Seq3 = 4 changes

Seq1:Seq4 = 7 changes

Seq1:Seq5 = 8 changes

 Repeat using each of the other sequences as the basis for comparison

Seq2:Seq1 = 3 changes                  Seq3:Seq1 = 4 changes

Seq2:Seq2 = 0 changes                  Seq3:Seq2 = 1 changes

Seq2:Seq3 = 1 changes                  Seq3:Seq3 = 0 changes

Seq2:Seq4 = 4 changes                  Seq3:Seq4 = 3 changes

Seq2:Seq5 = 5 changes                  Seq3:Seq5 = 4 changes

 

Seq4:Seq1 = 7 changes                  Seq5:Seq1 = 8 changes

Seq4:Seq2 = 4 changes                  Seq5:Seq2 = 5 changes

Seq4:Seq3 = 3 changes                  Seq5:Seq3 = 4 changes

Seq4:Seq4 = 0 changes                  Seq5:Seq4 = 1 changes

Seq4:Seq5 = 1 changes                  Seq5:Seq5 = 0 changes

 

Our input file is a FASTA format file of all sequences/species that has been previously aligned and trimmed.  There are some odd characters in the file, so we'll have to deal with that.

Posted Date: 2/25/2013 7:29:13 AM | Location : United States







Related Discussions:- Examine multiple variation parameters for a genomic region , Assignment Help, Ask Question on Examine multiple variation parameters for a genomic region , Get Answer, Expert's Help, Examine multiple variation parameters for a genomic region Discussions

Write discussion on Examine multiple variation parameters for a genomic region
Your posts are moderated
Related Questions
E. coli strains containing the plasmid pAMP are resistant to ampicillin. Describe how this plasmid functions to bring about resistance.

Q. Explain about Long acting insulin? Long acting: Long acting insulin does not work until 4 Lo 8 hours after injecting. Its peak activity occurs 18 to 24 hours after injectio

How do grasslands differ from Savannas? Name the two main categories of plant forms that dominate the desert vegetation.

Insulators Numerous experiments showed that a transgene is generally poorly expressed when it contains a cDNA rather than the corresponding genomic DNA; when it is integrated a

What is the structural representation of a carboxyl group? Carboxyl groups have a carbon attached to single hydroxyl group by a simple bond and to one oxygen by a double bond.

Can you give me an example of the species that crossed a few habitats?

What are the main structures of chloroplasts? Chloroplasts are included by two membrane layers, the outer and the inner membranes. Inside the organelle the formative unit is kn

How are the excretory systems of the three main arthropod classes constituted? In crustaceans a pair of excretory organs known as green glands exists. The green glands collect

Give an example of how two organisms are interdependent.

What is Menu Planning? Any individual who carries the responsibility of providing meals has to take decisions regarding what to serve, how much to serve, how much to spend, whe