Examine multiple variation parameters for a genomic region , Biology

  1. Determine SNP variation among the aligned DNAs for a genomic region.   See below for how to count SNP variation.  The output file (Your_name_snp.txt) should have two columns of numbers.  The first column will indicate total number of SNP sites per species and the second will be the percent of sequences/species having that same number of variant nucleotides.
  2. Determine in-del variation among the aligned DNAs for a genomic region. The output file (Your_name_in_del.txt) should be two columns of numbers.  The first column will indicate total number of in-del sites per species and the second will be the percent of sequences/species having that same number of in-del.
  3. Determine overall variation (SNPs and in-dels) among the aligned DNAs for a genomic region. The output file (Your_name_both.txt) two columns of numbers.  The first column will indicate total number of variant sites (SNP and in-del) per species and the second will be the percent of sequences/species having that same number of variant nucleotides.  This will generate the same data used for the figure on page 3.

Sample Alignment: 48 bases,  differences are highlighted

Seq1      ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Seq2      AAAAATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Seq3      AAAAATGCATGCATGCA-GCATGCATGCATGCATGCATGCATGCATGC

Seq4      AAAAATGCATGCATGCA-GCATGCATGCATTTTTGCATGCATGCATGC

Seq5      AAAAATGCATGCATGCA-GCATGCATGCATTTTTGCAT-CATGCATGC

Computation:  Compare Seq1 to 2,3,4, and 5 you find the differences (SNPs and InDels).

Seq1:Seq1 = 0 changes

Seq1:Seq2 = 3 changes

Seq1:Seq3 = 4 changes

Seq1:Seq4 = 7 changes

Seq1:Seq5 = 8 changes

 Repeat using each of the other sequences as the basis for comparison

Seq2:Seq1 = 3 changes                  Seq3:Seq1 = 4 changes

Seq2:Seq2 = 0 changes                  Seq3:Seq2 = 1 changes

Seq2:Seq3 = 1 changes                  Seq3:Seq3 = 0 changes

Seq2:Seq4 = 4 changes                  Seq3:Seq4 = 3 changes

Seq2:Seq5 = 5 changes                  Seq3:Seq5 = 4 changes

 

Seq4:Seq1 = 7 changes                  Seq5:Seq1 = 8 changes

Seq4:Seq2 = 4 changes                  Seq5:Seq2 = 5 changes

Seq4:Seq3 = 3 changes                  Seq5:Seq3 = 4 changes

Seq4:Seq4 = 0 changes                  Seq5:Seq4 = 1 changes

Seq4:Seq5 = 1 changes                  Seq5:Seq5 = 0 changes

 

Our input file is a FASTA format file of all sequences/species that has been previously aligned and trimmed.  There are some odd characters in the file, so we'll have to deal with that.

Posted Date: 2/25/2013 7:29:13 AM | Location : United States







Related Discussions:- Examine multiple variation parameters for a genomic region , Assignment Help, Ask Question on Examine multiple variation parameters for a genomic region , Get Answer, Expert's Help, Examine multiple variation parameters for a genomic region Discussions

Write discussion on Examine multiple variation parameters for a genomic region
Your posts are moderated
Related Questions
Q What is the alternative means for transport of substances in animals without a circulatory system? Why is blood important for larger animals? In animals that don't present th

Explain Metabolism of Iron? In this sub-section, we will study how body gets its iron supply, how iron is transported and utilized by the various tissues and how iron balance i

Define Unsafe Water and sanitation - public nutrition? Safe water and sanitation may seem tenuous in their link to food security but their impact is unquestionable. With 19% US

Define Nutritional Requirements for Extreme Environments? Human beings have been able to survive and work under extreme environments of almost all regions of the earth, from po


How is the respiratory system in aquatic molluscs divided? What adaptive respiratory structure do terrestrial molluscs present? Aquatic molluscs oxygenate their blood through g

Discuss the similarities and differences of transposable elements in E. coli, yeast, plants, and Drosophila.

Biotin Biotin forms long, colourless needles or a white crystalline powder. It is sparingly soluble in cold water, but more soluble in hot water and dilute alkalis. Biotin is s

Q. Show Gastrointestinal Diseases and Disorders? Before discussing the many gastrointestinal problems, it is useful to understand the basic physiology of the gastrointestinal t

Following fertilization by a normal sperm, what chromosome condition is created?