Examine multiple variation parameters for a genomic region , Biology

  1. Determine SNP variation among the aligned DNAs for a genomic region.   See below for how to count SNP variation.  The output file (Your_name_snp.txt) should have two columns of numbers.  The first column will indicate total number of SNP sites per species and the second will be the percent of sequences/species having that same number of variant nucleotides.
  2. Determine in-del variation among the aligned DNAs for a genomic region. The output file (Your_name_in_del.txt) should be two columns of numbers.  The first column will indicate total number of in-del sites per species and the second will be the percent of sequences/species having that same number of in-del.
  3. Determine overall variation (SNPs and in-dels) among the aligned DNAs for a genomic region. The output file (Your_name_both.txt) two columns of numbers.  The first column will indicate total number of variant sites (SNP and in-del) per species and the second will be the percent of sequences/species having that same number of variant nucleotides.  This will generate the same data used for the figure on page 3.

Sample Alignment: 48 bases,  differences are highlighted

Seq1      ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Seq2      AAAAATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Seq3      AAAAATGCATGCATGCA-GCATGCATGCATGCATGCATGCATGCATGC

Seq4      AAAAATGCATGCATGCA-GCATGCATGCATTTTTGCATGCATGCATGC

Seq5      AAAAATGCATGCATGCA-GCATGCATGCATTTTTGCAT-CATGCATGC

Computation:  Compare Seq1 to 2,3,4, and 5 you find the differences (SNPs and InDels).

Seq1:Seq1 = 0 changes

Seq1:Seq2 = 3 changes

Seq1:Seq3 = 4 changes

Seq1:Seq4 = 7 changes

Seq1:Seq5 = 8 changes

 Repeat using each of the other sequences as the basis for comparison

Seq2:Seq1 = 3 changes                  Seq3:Seq1 = 4 changes

Seq2:Seq2 = 0 changes                  Seq3:Seq2 = 1 changes

Seq2:Seq3 = 1 changes                  Seq3:Seq3 = 0 changes

Seq2:Seq4 = 4 changes                  Seq3:Seq4 = 3 changes

Seq2:Seq5 = 5 changes                  Seq3:Seq5 = 4 changes

 

Seq4:Seq1 = 7 changes                  Seq5:Seq1 = 8 changes

Seq4:Seq2 = 4 changes                  Seq5:Seq2 = 5 changes

Seq4:Seq3 = 3 changes                  Seq5:Seq3 = 4 changes

Seq4:Seq4 = 0 changes                  Seq5:Seq4 = 1 changes

Seq4:Seq5 = 1 changes                  Seq5:Seq5 = 0 changes

 

Our input file is a FASTA format file of all sequences/species that has been previously aligned and trimmed.  There are some odd characters in the file, so we'll have to deal with that.

Posted Date: 2/25/2013 7:29:13 AM | Location : United States







Related Discussions:- Examine multiple variation parameters for a genomic region , Assignment Help, Ask Question on Examine multiple variation parameters for a genomic region , Get Answer, Expert's Help, Examine multiple variation parameters for a genomic region Discussions

Write discussion on Examine multiple variation parameters for a genomic region
Your posts are moderated
Related Questions
Maintenance in the Continuing Care Cycle Impaired dexterity: Any impairment of dexterity, even if it is temporary, may be detrimental to dental implants because home maintena


Explain about the Glycoproteins? Most of the naturally occurring conjugated proteins are glycoproteins. Sugar molecules are covalently bound to them, especially those secreted

Sedge-Meadow Stage - Hydrarch Favoured by an increasing amount of light, as the former occupants disappear, they gradually change the reed swamp into a sedge meadow. And now s

Q. What is an example of a lab experiment that shows the variation of the photosynthesis effectiveness in relation to different photic energy frequencies to which the reaction is e

What are the chemical substances formed by water photolysis? What is the destination of each of those substances? Free electrons, hydrogen ions and molecular oxygen are liberat

General process of post-hatching growth in insects While a young insect hatches out from an egg it is covered by a firm, inflexible, sclerotized cuticle, which because of its

In the lack of tryptophan shown in the figure, a trp repressor protein encoded by a split operon, trpR that is synthesized and forms a dimer.  Furthermore, this is inactive and so

Q. Corelation of ST Depressoin with Coronary Angiography? Various investigators considered 1 mm of horizontal or downsloping ST depression to denote a positive test and used fr

Q. Differentiate between sterilization and disinfection? 1) Sterilization is defined as freeing the object or substance from all life of any kind. It is the process by which a