Examine multiple variation parameters for a genomic region , Biology

  1. Determine SNP variation among the aligned DNAs for a genomic region.   See below for how to count SNP variation.  The output file (Your_name_snp.txt) should have two columns of numbers.  The first column will indicate total number of SNP sites per species and the second will be the percent of sequences/species having that same number of variant nucleotides.
  2. Determine in-del variation among the aligned DNAs for a genomic region. The output file (Your_name_in_del.txt) should be two columns of numbers.  The first column will indicate total number of in-del sites per species and the second will be the percent of sequences/species having that same number of in-del.
  3. Determine overall variation (SNPs and in-dels) among the aligned DNAs for a genomic region. The output file (Your_name_both.txt) two columns of numbers.  The first column will indicate total number of variant sites (SNP and in-del) per species and the second will be the percent of sequences/species having that same number of variant nucleotides.  This will generate the same data used for the figure on page 3.

Sample Alignment: 48 bases,  differences are highlighted

Seq1      ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Seq2      AAAAATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Seq3      AAAAATGCATGCATGCA-GCATGCATGCATGCATGCATGCATGCATGC

Seq4      AAAAATGCATGCATGCA-GCATGCATGCATTTTTGCATGCATGCATGC

Seq5      AAAAATGCATGCATGCA-GCATGCATGCATTTTTGCAT-CATGCATGC

Computation:  Compare Seq1 to 2,3,4, and 5 you find the differences (SNPs and InDels).

Seq1:Seq1 = 0 changes

Seq1:Seq2 = 3 changes

Seq1:Seq3 = 4 changes

Seq1:Seq4 = 7 changes

Seq1:Seq5 = 8 changes

 Repeat using each of the other sequences as the basis for comparison

Seq2:Seq1 = 3 changes                  Seq3:Seq1 = 4 changes

Seq2:Seq2 = 0 changes                  Seq3:Seq2 = 1 changes

Seq2:Seq3 = 1 changes                  Seq3:Seq3 = 0 changes

Seq2:Seq4 = 4 changes                  Seq3:Seq4 = 3 changes

Seq2:Seq5 = 5 changes                  Seq3:Seq5 = 4 changes

 

Seq4:Seq1 = 7 changes                  Seq5:Seq1 = 8 changes

Seq4:Seq2 = 4 changes                  Seq5:Seq2 = 5 changes

Seq4:Seq3 = 3 changes                  Seq5:Seq3 = 4 changes

Seq4:Seq4 = 0 changes                  Seq5:Seq4 = 1 changes

Seq4:Seq5 = 1 changes                  Seq5:Seq5 = 0 changes

 

Our input file is a FASTA format file of all sequences/species that has been previously aligned and trimmed.  There are some odd characters in the file, so we'll have to deal with that.

Posted Date: 2/25/2013 7:29:13 AM | Location : United States







Related Discussions:- Examine multiple variation parameters for a genomic region , Assignment Help, Ask Question on Examine multiple variation parameters for a genomic region , Get Answer, Expert's Help, Examine multiple variation parameters for a genomic region Discussions

Write discussion on Examine multiple variation parameters for a genomic region
Your posts are moderated
Related Questions
Sporadic exertional  rhabdomyolysis (azoturia, tying up in horses) Azoturia is a metabolic condition of horses that is characterized by reluctance to move and poor performance.

Q. Energy during myocardial infarction? As mentioned above, patient who have recently suffered from an attack of myocardial infarction are hospitalized in the intensive cardiac

PLASM A - It is slightly alkaline non-living intercellular substance which constitutes about 60% part of the blood. It is a pale yellow but transparent and clear fluid.

Third Week - Embryonic Development Throughout the third week of development the ICM separates from the uophoblast and forms the flattened embryonic disc, which at first consi

CILIA AND FLAGELLA Purkinj e first observed ciliary movement. Hodge studied detail structure of sperm flagellum. Manton studied structure of cilia in plants.

Preliminary treatment of implant therapy It is important to ensure a healthy oral environment before going ahead with implant procedure. The treatment needs to be initiated in

Q. Is the upward move of warm air good or bad for the dispersion of pollutants? An upward movement of warm air is a natural method of dispersion of pollutants. The air near the

what are the characteristis in species in the phyla division

Which of the following statements least accurately explains our knowledge of how gene number relates to "organismal complexity"? A. Based on known gene numbers there appears to

What are mineral salts? Where in living beings can mineral salts are found? Mineral salts are simple inorganic substances made of metallic chemical elements, such as iron, sodi