epithelial tissues., Biology

function , structure and lo of location of germinal epithelium

Posted Date: 2/16/2013 10:17:27 AM | Location :







Related Discussions:- epithelial tissues., Assignment Help, Ask Question on epithelial tissues., Get Answer, Expert's Help, epithelial tissues. Discussions

Write discussion on epithelial tissues.
Your posts are moderated
Related Questions
Define the control of tear production. Control of Tear Production The lacrimal secretary system was initially thought to be comprised of two parts, basic secretors and r

Which of the following is true for a primary motor cortex (M1) corticospinal interneuron that produces action potentials during movements of the big toe of the right foot? A. A

Metallurgical coke should have following characteristics: 1.      Purity: low amounts of moisture, ash, sulphur & phosphorous should be present. 2.      Porosity: it should b



Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Q. Explain about Oral Glucose Tolerance Test? This is most commonly used diagnostic test particularly for identifying new and ‘at risk' individua1s.Thi.s test is carried out af

What are the cell types that form the phloem? What are the main features of those cells? The major cells that form the phloem are the sieve elements and the companion cells. Th

Q. How are the excretory systems of the three major arthropod classes constituted? In crustaceans a pair of excretory organs called green glands exists, the green glands collec

What are the main harms caused by vitamin A deficiency? How does this vitamin act in the physiology of vision? Deficiency of vitamin A (retinol) might be cause night blindness