Determine cdna encodes aba 8-hydroxylase activity, Biology

Hypothetical question. A new biotech company intends to clone the gene encoding the ABA 8-hydroylase enzyme, an important protein regulating plant hormone degradation that controls seed dormancy and environmental stress responses. The protein is known to belong to a class of enzymes known as p450s of which there are 500 different genes in Arabidopsis, the model plant system. The company isolates a full length cDNA for each gene using PCR with primerscontaining attB sequences and then each individually cloned into pDONR/Zeo (from Invitrogen) via a BP reaction for all 500 different p450 genes from Arabidopsis (the cDNAs vary in length from 1.5-2.5 kb). Next the company proposes to express each gene in yeast, and then carry out an ABA-8 hydroxylase reaction in vivo to determine which cDNA encodes ABA 8-hydroxylase activity.

Outline a cloning strategy(s) (experimental procedure) the company could take to express all these genes in yeast - a simple flow diagram detailing the steps is all that is needed. Design a vector(s) that would be central in this strategy (can just draw by hand) and list all the important features that would be required (i.e what cloning sites or antibiotic resistance genes would be required if any) but not any features that would be excess to what is required.

 

Posted Date: 3/11/2013 1:34:21 AM | Location : United States







Related Discussions:- Determine cdna encodes aba 8-hydroxylase activity, Assignment Help, Ask Question on Determine cdna encodes aba 8-hydroxylase activity, Get Answer, Expert's Help, Determine cdna encodes aba 8-hydroxylase activity Discussions

Write discussion on Determine cdna encodes aba 8-hydroxylase activity
Your posts are moderated
Related Questions
Define the Role of Thiamin in the conversion carbohydrate to fats? Thiamin helps in the initial steps of fatty acid and sterol production. In this way, thiamin also helps co

Define the Solar Concentration? As in food dehydration, one of the simplest methods of evaporating water is with solar energy. A typical example of this method is production a

Prepare a dichotomous key the following organisms, ant, butterfly, fly, beetle, grass hopper, wasp, ladybug, roach and dragonfly

Mandibular Ramus Serves as an intraoral autogenous bone donor site. Cortical bone upto 4mm thickness may be harvested from the ramus. Harvest of bone from this area requires kn

An A=T mispairing leads to an A=C substitution. The other DNA helix will contain a(n) __ pair. a. A=C b. A=T c. G=C d. B=Q e. T=T Can you also explain it please so if I'm ask

If given this in this sequence to find surface area, 1 cm x 2 cm x 2 cm block, am I to assume it is written in LxWxH format? I actually think the length is 2 though and the width i

merits and demerits system of classification by Linnaeus

Availability of nutrients in soils  The productivity of a crop depends largely on the nutrients discussed in the previous section. It is important to find out methods which wil

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Removal of a patient's peripheral intravenous catheter resulted in brief bleeding and the loss of a small amount of blood. Which of the following processes occurred during the form