Define advantages for underwater weighing method, Biology

Define Advantages for underwater weighing method?

  • This method is currently considered the "gold standard in percent body fat measurement (with the coming up of DEXA, the debates are still on).
  • Repeat measures usually prove consistent, and can be used to chart progress.
  • Air Displacement Plethysmography (ADP)
Posted Date: 6/20/2013 5:13:29 AM | Location : United States







Related Discussions:- Define advantages for underwater weighing method, Assignment Help, Ask Question on Define advantages for underwater weighing method, Get Answer, Expert's Help, Define advantages for underwater weighing method Discussions

Write discussion on Define advantages for underwater weighing method
Your posts are moderated
Related Questions
Plant sources Although there is a multitude of colours in the plant kingdom, their extraction and use in food systems is not an easy task. Unless the colourants have some outst

Which theory focuses on how people are different than animals? Functionalism Eclecticism Humanism Behaviorism

What is Burden of Rheumatic Heart Diseases? Although in the twenty-first century RHD has been eradicated in western countries, in India and other developing countries it contin

How many different molecules composed of (A) two (B) three, and (C) four amino acids, linked together by peptide bonds, can be made from the set of 20 naturally occurring amino aci

Indifferences in ionic composition Answer A. across membranes can be created through the action of ATP driven pumps as long as number of negative and positive ions on remain equal

Q. Concerning reproduction what is the function of the testicles? The testicles are the male gonad that is the organs where the production of gametes takes place. In human bein

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Adaptations to high wind velocity The mechanical force of the wind and the grinding action of sand, dust, snow and other materials driven by it cause the plants to adapt themse

Explain in details about Respiratory system Respiratory system starts from nostrils through which we inhale air in the nasal cavity. Then, air enters pharynx and goes through l

what is the population for percentage of people being overweight