Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Cyanide - Enzyme-activity Control
Plants generate cyanide from cyanogenic glucides and histidines. Ethylene biosynthesis is also accompanied by cyanide production. Nitrate reductase can occur in reduced form following its interaction with NADH in the absence of nitrate. The reduced form of the enzyme has the ability to combine with cyanide forming enzyme-CN complex which is enzymatically inactive. Nitrate, blue light or oxygen oxidise the enzyme-CN complex releasing cyanide.
The cyanide free enzyme regains its activity. Hydroxyl amine or superoxide inactivates the enzyme which on exposure to blue light gets converted to active form. It is observed that plants grown in blue light are higher in protein contents. Blue light regulation of nitrate reductase activity may be one of the primary factors responsible for higher protein synthesis.
Q. What are plasmids? And what is the significance of plasmids for the recombinant DNA technology? Plasmids are circular fragments of DNA that are accessories to the main bacte
Bacteriophage Vectors Bacteriophages are viruses that attack bacteria. Mainly phage lyses the bacterial cells they infect (lytic phages). But many others may choose to follow e
Q. What do you know about Vascular Access ? Femoral and brachial arteries are still the commonest routes of access for aortography. Thoracic Aorta A sound knowledge of
Q What are the few examples of arthropods? Ants, crabs, cockroaches, shrimps, flies, spiders and scorpions are examples of arthropods.
Determine the genotypes and phenotypes of the F1 generation from a colour blind father and a mother who is homozygous for normal colour vision.
Q. What is the neuromuscular synapse? Neuromuscular synapse is the structure through which the neural impulse passes from the axon of a motor neuron to the muscle cell. This st
Metabolic Disorders The disease conditions, which are attributable to an imbalance between rates of input of dietary nutrients and the output of production, are defined as pro
What are respectively some remarkable functions of myosin, CD4, albumin, keratin, immunoglobulin, reverse transcriptase, hemoglobin and insulin? Myosin is a protein that when a
Define the interaction of vitamin c with iron and cadmium? Toxic levels of dietary cadmium (5-200 ppm) interfere with iron absorption and produces iron deficiency. Supplements
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd