Cell theory, Biology

Cell Theory

The term cell was first used by an English cytologist, Robert Hooke (1665) not for unit protoplasmic masses, but for the well defined and empty compartments, he observed in a thin slice of cork under his self invented   microscope. This finding of Hooke was cork is a dead and dry plant material. Obviously, what Hooke actually   observed were empty cells with cellulose walls originally produced by the living cells they surrounded, yet the term cell has since been retained and universally adopted for unit protoplasmic masses of live organisms.

Leeuwenhoek (1674-76) discovered free living cells. He also observed the presence of a distinct central structure in certain unicellular organisms and some cells of multicellular organisms.  Robert brown (1831) discovered that a central structure is an essential is an essential part of all living cells. He named it as nucleus first observed the jelly like protoplasm in living   cells and termed it arcade. When observation upon varied types of cells and unicellular organisms many scientists during17th and 18th centuries were leading to the realization that plants and animals were made up of component cells. Two German biology Matthias j Schleiden and Theodor Schwann (1938-39) separately formulated. Famous cell theory stating that cells are the basic structural and functional unit or building blocks of the bodies of all organisms, like the bricks of house. Thus this cell theory came as the most fundamental biological generalization implying a common pattern of body architecture in all living beings. 

Posted Date: 9/26/2012 7:01:33 AM | Location : United States







Related Discussions:- Cell theory, Assignment Help, Ask Question on Cell theory, Get Answer, Expert's Help, Cell theory Discussions

Write discussion on Cell theory
Your posts are moderated
Related Questions
Explain the Jejuno ileal Bypass and Jaw Wiring? Jejuno-ileal Bypass: Absorptive surface of the small intestines can also be reduced through surgery called the jejuno-ileal by p

Explain the Nutritional Factors that affecting food choice? Food choices made based on sound principles of nutrition will be conducive to good health while carelessness about n

Difference between Adrenergic and Cholinergic Fibre- S.NO .   1. ADRENERGI C FIBRE   Release nor adrenaline at their CHOLINE

DERMIS (CORIUM) - Mesodermal in origin. More developed part. Leather is obtained from dermis by tanning. Thinnest in eye lid. Connective tissue present. In it 4 types

Levels of organization of Matter- Metazoa The smallest structural units of all matter are subatomic particles, mainly electrons, protons and neutrons. The next larger units a

Q. Why are pteridophytes more common in humid places? Pteridophytes are more common in humid places since they depend on water for their gametes to fecundate one another. In hu

What is Class Gastropoda in animal kingdom? Snails and slugs are referred to as gastropods because of their characteristic body plan. "Gastro" is derived from the Greek word fo

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

CARBOHYDRATE METABOLISM Carbohydrates  are  broken down into  monosaccharides which are absorbed into  the  blood stream.  In  the  liver and muscles, most  of  the glucose  is

Organizational assessments are vital to the introduction of Nurse Case Management (NCM) and Clinical Nurse Leaders (CNL)  ( I am in school for the CNL) Use the guidelines below