cell cycle, Biology

What can stop a normal cell from growing?
Posted Date: 11/12/2012 10:00:25 PM | Location : United States







Related Discussions:- cell cycle, Assignment Help, Ask Question on cell cycle, Get Answer, Expert's Help, cell cycle Discussions

Write discussion on cell cycle
Your posts are moderated
Related Questions
Q.How is it produced and what is the function of gastrin in the digestive process? The existence of food in the stomach stimulates the secretion of gastrin that in its turn tri

Why is there little or no grass in the forest? 1. Because of the presence of the bushy trees close together in the forest, sunlight does not penetrate simply to the ground. Thi

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Q. Define Eye Balling? Ans. Two-dimensional echocardiography provides a good visual perception of cardiac functions. With experience, the echocardiologist learns to percei

Spermiogenesis - Spermatogenesis At the end of the meiosis the spermatids appear as simple spherical cells with a centrally located nucleus. Their differentiation into sperm r

What are the typical components of a closed circulatory system? The typical components of the closed circulatory system are the blood vessels within which blood circulates (vei

Use of Beta-blockers :  In some centres, patients are routinely put on beta-blockers after CABG. European coronary artery surgery study showed that only 25 per cent of patient

Biotolerant materials, are characterized by a thin fibrous tissue interface. The fibrous tissue layer develops as a result of the chemical products from leaching processes, leading

Define the Prevention of iron deficiency anaemia? As in the case of vitamin A deficiency, correction and prevention of dietary inadequacy of iron are important sustainable meth

In cats, curled ears (Cu) results from an allele that is dominant over an allele for normal ears (cu). Black colour results from an independently assorting allele (G) that is domin