blood flow systemic circuit (hepatic portal system) and the , Biology

Trace the flow of blood through the systemic circuit (hepatic portal system) and the pulmonary circuit, beginning and ending in the left ventricle. You will be using named chambers, vessels, and valves. Hint: since you are starting and ending in the left ventricle, your first and last answer will be valves.
Answer
Left atrium


4 pulmonary veins


Pulmonary capillaries (capillaries of the lungs)


Bicuspid (mitral) valve


Pulmonary semilunar valve


Right ventricle


Mesenteric capillaries (capillaries of the small intestine)


Tricuspid valve


Pulmonary venules


2 pulmonary arteries


Hepatic capillaries (capillaries of the liver)


Right atrium


Inferior vena cava


Pulmonary trunk


Hepatic vein


Hepatic portal vein


Aortic semilunar valve


Pulmonary arterioles


Aorta


Mesenteric artery
Posted Date: 11/4/2012 5:59:18 AM | Location : United States







Related Discussions:- blood flow systemic circuit (hepatic portal system) and the , Assignment Help, Ask Question on blood flow systemic circuit (hepatic portal system) and the , Get Answer, Expert's Help, blood flow systemic circuit (hepatic portal system) and the Discussions

Write discussion on blood flow systemic circuit (hepatic portal system) and the
Your posts are moderated
Related Questions
Terminal process of diseased stage This is the last stage in the process of disease. In this stage, the disease process is halted either temporarily or permanently. There are t

Cultured plant cells: Cultured plant cells are recognized to give biochemicals of interest since  1950's , but starting the yields were very low. Refined culture structures hav

What is the difference between embryo and endosperm?

Gene expression must begin with the process of transcription a)  Describe the promoter motifs commonly associated with eukaryotic protein-coding genes, and explain their influen

Q. Protein Requirement during congestive cardiac failure? Protein: The protein requirements remain the &me as healthy adult men and women, About 0.8 - lg of protein per kg

Q. Distinguish among the terms stimulus, sensation, and perception? A stimulus is an energy source (chemical, light wave, pressure etc.) which activates a receptor cell (specia

Define hexose monophosphate pathway The hexose monophosphate pathway (HMP also called the pentose phosphate pathway, or phoshogluconate pathway) consists of Mo irreversible o

For an individual having a genotype formed of two different alleles that condition different varieties of the same phenotypical trait, upon what will the phenotypical feature actua

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Food applications of CMC In common with other linear water-soluble polymers, cellulose gum solutions are pseudoplastic that is the viscosity decreases as the  rate of shear inc