Blood and its composition, Biology

BLOOD -

  1. Blood is a mobile connective tissue composed of a fluid, the plasma and the cells, the blood corpuscles.
  2. Blood is basis of life.
  3. Blood is the softest tissues in the body.
  4. Fluids outside the cells are generally called extracellular fluids (ECF).
  5. Blood forms about 30-35 percent ofthe ECF.
  6. The volume of blood in an adult person of 70 kg weight is about 5.5 litres.
  7. It is a slightly alkaline fluid having pH 7.4. pH of blood in arteries is more than in veins.

COMPOSITION -

Blood is composed of a watery fluid called plasma and floating bodies termed formed elements (e.g., blood corpuscles).

Posted Date: 10/1/2012 3:18:37 AM | Location : United States







Related Discussions:- Blood and its composition, Assignment Help, Ask Question on Blood and its composition, Get Answer, Expert's Help, Blood and its composition Discussions

Write discussion on Blood and its composition
Your posts are moderated
Related Questions
Define Interaction of Folate with Vitamin C? Vitamin C: Anaemia is observed in vitamin C deficient patients. Normochromic, normocytic or macrocytic or megaloblastic ana

Clinical Evaluation of Infants and Young Children Approaches to clinical practice advanced in recent year are mostly directed at older children and adolescents. There has not b

Explain the Carbohydrate required for underweight - Nutritional Care? Liberal amounts of easy to digest carbohydrates should be included in the diet. The intake of dietary fibr

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Question 1 How would you perform prothrombin time (PT) test? What are the precautions to be taken while performing the test to avoid errors? List various factors that affect the a

Viscosity The viscosity at temperatures above its gelation point is relatively constant  at pH values of 4.5  to 9.0 and is not greatly affected by age or ionic strength within

The main point of control of β-oxidation is the availability of fatty acids.  The major  source   of  free  fatty   acids   in  the  blood   is  from   the  breakdown   of triacylg


Drugs for Sexually Transmitted Infections Many infections can be transmitted during sexual contact. The text and tables that follow are limited to management of sexually transm

Where is the gall bladder located? The gall bladder is located in the Upper Right Quadrant (URQ) of the abdomen just below the liver. It keeps bile secreted by the liver. The d