Bacterial diseases- braxy, Biology

Braxy


The causative agent of braxy is Cl. septicum. It usually affects lambs. The agent is a normal inhabitant of soil and is frequently found in the faeces of herbivores. Braxy is a form of malignant oedema of abomasums. The incidence is highest in hill tracts. The exact conditions of microenvironment which favours the growth of organism are unknown. The disease occurs in an acute form. The animals die without showing symptoms however the affected animals may show signs of abdominal pain and frothing from mouth and diarrhoea due to toxaemia. On post-mortem examination, inflammation of stomach wall characterized by the congestion, ulceration and necrosis may be observed. Laboratory examination include cultural examination of cut surfaces of the abomasal wall or heart blood. The disease can be controlled by inoculation of formalinized whole culture of Cl. septicum to the animals which confers a satisfactory immunity.

Posted Date: 9/17/2012 5:50:13 AM | Location : United States







Related Discussions:- Bacterial diseases- braxy, Assignment Help, Ask Question on Bacterial diseases- braxy, Get Answer, Expert's Help, Bacterial diseases- braxy Discussions

Write discussion on Bacterial diseases- braxy
Your posts are moderated
Related Questions
Q. What are the three fundamental sexual life cycles studied in Biology? Which of them corresponds to metagenesis? Which of them is the human life cycle? Sexual reproduction ma

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Q. What is Impaired Glucose Tolerance? Glucose tolerance is assessed by taking the fasting blood sugar value. An oral glucose load of 75 grams glucose is administered and blood

general character of class sarcodina

Individuals of the following genotype are crossed: aa BB Cc Dd (crossed with) Aa Bb Cc Dd A) How many different phenotypes are possible for the progeny? B) What are the chanc

Q. To which phase of the plasmodium life cycle do the typical chills and fever of malaria correspond? The typical fever and chills episodes of malaria correspond to the phase w

Define Evolution of virulence? Diseases like cholera emerge as sudden outbreaks, showing marked variation via space and time both in their incidence--the number of individuals

The secretary coil fills the lumen with a NaCl solution that is isotonic with the blood plasma. As this solution moves upward through the reabsorptive duct, NaCl is reabsorbed into

Q. What are the phospholipids? Phospholipids are molecules made of glycerol bound to one phosphate group and to two long molecules of fatty acids. hence, phospholipids are amph

MUSCLES - In eye orbit, eye ball is fixed by 6 skeletal muscles attached to 3rd, 4th & 6th cranial nerves (motor). 4 - straight or recti muscles are present. 2 - oblique