Anther, Biology

Anther is the top of a stamen's filament; divided into pollen sacs in which the pollen grains are form.

498_anther.png

Posted Date: 8/1/2012 5:09:45 AM | Location : United States







Related Discussions:- Anther, Assignment Help, Ask Question on Anther, Get Answer, Expert's Help, Anther Discussions

Write discussion on Anther
Your posts are moderated
Related Questions
Determine Some Guidelines for Cancer Prevention? The guidelines for cancer prevention focus on the following: 1. Include plant-based diet, limiting red meat in particular.

Change of Health Status Over Time Health of a nation can be gauged from the available information on death.Disaggregated data by causes of death is more reflective of the status

Ganglia - Organisation of Nervous System In between higher non-chordates with a central nervous system, you will observe that the association neurons and motor neurons are con

ROLE OF PSYCHIATRIC NURSE: In Blocks 2 and 3 you have learnt about various therapeutic interventions  for mental disorders  like anxiety neurotic disorders, psychotic disorder

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain diet from Lifestyle Risk Factors ? The lifestyle factors are the way of living of an individual and comprise of the diet, smoking, alcohol, physical activity and stress

Q. Show the Error Detection and Editing Function? Error Detection and Editing Function: Consciousness helps us avoid acting solely through habit. It allows us to make novel res

Define Citrate Utilization Test - imvic test? Several microorganisms have the ability to make use of citrate as the sole source of carbon and energy. This ability relies on the

What are protein hydrolysates? Proteins that have been treated with enzymes to break them down into amino acids or shorter peptides are referred to as protein hydrolysates. Pr

Contig:  Number of uses, all nouns. The term comes from the shortening of the word 'contiguous'. A 'contig' might refer to the map showing placement of a set of clones which comple