What would be the best choice of the degree

Assignment Help Basic Computer Science
Reference no: EM13208155

A B+ - tree index is to be built on the name attribute of the relation student. Assume that all the student names are o length 8bytes, disk blocks are of size 512 bytes , and index pointer are of size 4bytes. Given this scenariom, what would be the best choice of the degree of the B+ - tree?

Reference no: EM13208155

Questions Cloud

Are demand functions homogeneous in income and prices : Suppose David spends his income (I) on two goods, x and y, whose market prices are px and py, respectively. His preferences are represented by the utility function u(x,y) = lnx + 2lny (MUx= 1/x; MUy= 2/y). a. Derive his demand functions for x and y. ..
Write a simple computer program : Write a simple computer program that ask the user for coordinate value in certain form, and then reports the number in all three forms. This will be repeated for input coordinates of all three forms.
Explain what volumetric flow rate of fuel gas : The flue gases leave the heater at 410 F. Of the entering methane, 70% burns to carbon dioxide and 30% burns to carbon monoxide. What volumetric flow rate of fuel gas is required if there are no heat losses to the surroundings?
What is the order of the leaf node : The order of a leaf node in a B+ tree is the maximum number of pairs it can hold. Given that the block size is 1K bytes, data record pointer is 7 bytes long, the value field is 9bytes long and a block pointer is 6bytes long, what is the order of t..
What would be the best choice of the degree : A B+ - tree index is to be built on the name attribute of the relation student. Assume that all the student names are o length 8bytes, disk blocks are of size 512 bytes , and index pointer are of size 4bytes. Given this scenariom, what would be th..
Why farmers may be better-off when harvests are low : In order to reduce farm output, raise farm prices, and thus raise farm incomes (revenues), the government pays farmers to set aside a portion of their land from production. Using a graph, explain in terms of the elasticity of demand for farm produ..
Compute the mass of the particle in kilograms : a particle has a velocity equal to 0.25 c and a wavelength of 1.3 x 10^-16 m. Calculate the mass of the particle in kilograms. c=3.0 x 10^8 m/s
Prepare a statement of cash flows : Prepare a statement of cash flows (indirect method) for the year ended December 31, Year 2 and prepare a side-by-side comparative statement contrasting two bases of reporting: (1) net income and (2) cash flows from operations.
Write the function xsort which takes in a list of strings : Write the function Xsort wich takes in a list of strings and returns sorted list with all words beginning wih "X" first in the list. f.ex: xsort (['kex', 'xylofonn', 'epli', 'xenos', 'asni']) returns ['xenos', 'xylofonn', 'asni', 'epli', 'kex'] th..

Reviews

Write a Review

Basic Computer Science Questions & Answers

  User can input an odd number in the range from 1 - 25

this pattern (9 rows), modify your program so that your user can input an odd number in the range from 1 - 25 for the number of rows in the diamond.

  Technology in home-workplace has negative impact on women

What technology in the home and workplace has a negative impact on women, if any; and (b) do women roles still remain largely associated with the home and domestic chores.

  Results of password cracker designed for operating system

Download a password cracker designed for your operating system. Run the cracker on your system. Explain the results from the cracker.

  Create the data model segment for business rules

The FlyRight Aircraft Maintenance (FRAM) division of FlyRight Company (FRC) does all maintenance for FRC's aircraft. Create the data model segment which reflects the following business rules.

  Identify position-indicate what pattern is found in thread

Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

  Implementing strong password policy

How do you implement strong password policy given dilema of forgotten passwords? How would you address these issues?

  Create a set of instructions

Provide a private address to be used for the AS and a public address to be used to connect to an ISP router connected to a border router.Create a set of instructions for the lab that would have students create a basic configuration and test connecti..

  Deployment and ongoing operation after implementations

Your plan requires two sections, one for deployment and another for ongoing operation after implementation. The vendor offers a contracting service for installation at $140 per hour.

  Simple math quiz that asks a user

Construct a simple math quiz that asks a user to answer a math problem of your choice. On the form, place one text box (txtAnswer) and two command buttons (cmdAskQuestion and cmdVerifyAnswer).

  User interface design guidelines used for new system

Design a suitable source document for ads that are telephoned or mailed in. Suggest at least four user interface design guidelines that could be used for the new system.

  A virtual boolean method that indicates

Data members should include all those inherited plus any you want to add  Member functions should include any inherited methods, plus at least  A virtual Boolean method that indicates whether the player gets another card  A method that announces that..

  Variety of information gathering methods available

There are a variety of information gathering methods available to assist in the determination of system requirements. If you were in charge of developing a system to automate medical records in a hospital.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd