Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
For many experiments, it is desirable to have a population of cells that are traversing the cell cycle synchronously. One of the first, and still often used, methods for synchronizing cells is the so-called doubled thymidine block. When high concentrations of thymidine are added to the culture fluid, cells in S-phase stops DNA synthesis, though other cells are not affected. The excess thymidine blocks the enzyme ribonucleotide reductase, which is responsible for converting ribonucleotides into deoxyribonucleotides. When this enzyme is inhibited, the supply of deoxyribonucleotides falls and DNA synthesis stops. When the excess thymidine is removed by changing the medium, the supply of deoxyribonucleotides rises and DNA synthesis resumes normally.
For a cell line with a 22 h cell cycle divided so that M phase= 0.5 hour, G1 phase= 10.5 hours, S phase= 7 hours, and G2 phase= 4 hours, a typical protocol for synchronization by a double thymidine block would be as follow:at 0 hours ( hours) add excess thymidineafter 18 hours ( hours) remove excess thymidineafter an additional 10 hours ( hours) add excess thymidineafter an additional 16 hours ( hours) remove excess thymidine
A) at what point in the cell cycle is the cell population when the second thymidine block is removed?
B) Explain how the times of addition and removal of excess thymidine synchronize the cell population
Critically illustrate out the cause, source and extent of diarrhetic shellfish poisoning, including an opinion on its occurrence and management in Canada and the USA.
Estimate hat makes shimwellia blattae the ideal candidate host for insecticide? Insects will require to be infected with this bacterium to deliver the insecticide.
Make sure you include a labeled picture of what you are comparing your cell to (even though my picture is not labeled. This is NOT a picture of a cell, but of a soccer field or Pizza hut, or a car etc.)
Present the comparison of clinical benefit of the use of drugs for Parkinson's Disease. What combination therapies can be beneficial - present the most current strategies for the treatment of Alzheimer's Disease.
A mutant prostist is found in which some mitochondria lack an inner mitochondrial membrane. Which pathways would be completely disrupted in these mitochondria.
1. the following series of nucleotide bases forms part of a dna molecule tacttatgacacaggaggacta convert this string of
Evaluate the functions of the ventricles of the brain and the choroid plexus, including their role in the formation and maintenance of CSF
You are investigating YFP, a transcription factor that binds directly to DNA. You know that it recognizes the sequences.
Black coat color in Cocker Spaniels is governed by a dominant allele and red coat by a recessive allele; solid pattern is governed by the dominant allele of another gene and spotted pattern is recessive.
operons can be activated by low levels of oxygen... glucose adp and atp and in sustained strenuous physical activity.
Suppose you are interested in studying dogs as a system for obesity. You crossed a Cocker Spaniel to a Labrador Retriever and interbred the offspring for many generations.
1. What is the difference between getting energy from cellular respiration and getting energy from a log by burning it? 2. Why does the body need to utilize both aerobic and anaerobic respiration?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd