What point in the cell cycle is the cell population

Assignment Help Biology
Reference no: EM131128942

For many experiments, it is desirable to have a population of cells that are traversing the cell cycle synchronously. One of the first, and still often used, methods for synchronizing cells is the so-called doubled thymidine block. When high concentrations of thymidine are added to the culture fluid, cells in S-phase stops DNA synthesis, though other cells are not affected. The excess thymidine blocks the enzyme ribonucleotide reductase, which is responsible for converting ribonucleotides into deoxyribonucleotides. When this enzyme is inhibited, the supply of deoxyribonucleotides falls and DNA synthesis stops. When the excess thymidine is removed by changing the medium, the supply of deoxyribonucleotides rises and DNA synthesis resumes normally.

For a cell line with a 22 h cell cycle divided so that M phase= 0.5 hour, G1 phase= 10.5 hours, S phase= 7 hours, and G2 phase= 4 hours, a typical protocol for synchronization by a double thymidine block would be as follow:
at 0 hours ( hours) add excess thymidine
after 18 hours ( hours) remove excess thymidine
after an additional 10 hours ( hours) add excess thymidine
after an additional 16 hours ( hours) remove excess thymidine

A) at what point in the cell cycle is the cell population when the second thymidine block is removed?

B) Explain how the times of addition and removal of excess thymidine synchronize the cell population

Reference no: EM131128942

Questions Cloud

Financial statements contain the following selected data : Yahoo! Inc.'s 2006 financial statements contain the following selected data (in thousands).
What would be the total contributions and value of account : An employee contributes $200 a year (at the end of the year) to her pension plan. What would be the total contributions and value of the account after five years? Assume that the plan earns 15% per year over the period.
Proportion of erroneous income tax returns filed with irs : If the annual proportion of erroneous income tax returns filed with the IRS can be looked upon as a random variable having a beta distribution with α = 2 and β = 9, what is the probability that in any given year there will be fewer than 10 percent..
What is the consumer surplus in this market : What is the consumer surplus in this market?
What point in the cell cycle is the cell population : At what point in the cell cycle is the cell population when the second thymidine block is removed - explain how the times of addition and removal of excess thymidine synchronize the cell population
A certain kind of appliance requires repairs : A certain kind of appliance requires repairs on the average once every 2 years. Assuming that the times between repairs are exponentially distributed, what is the probability that such an appliance will work at least 3 years without requiring rep..
The revenue earned by playing the first home game : Emporia State University sells 4,000 season basketball tickets at $180 each for its 12-game home schedule. Give the entry to record
Compare and contrast three to five diversity theories : Analyze key instances in which you have experienced each diversity theory in action in your own life, focusing on events that took place in a K-12 environment.
What will be the difference after 30 years between two optio : If an investor wants to contribute $15,000 before taxes to an IRA, what will be the difference after 30 years between the two options? Assume that the investor is currently in the 25% tax bracket, and that the IRA will earn 6% per year.

Reviews

Write a Review

Biology Questions & Answers

  Extent of diarrhetic shellfish poisoning

Critically illustrate out the cause, source and extent of diarrhetic shellfish poisoning, including an opinion on its occurrence and management in Canada and the USA.

  Ideal candidate host for insecticide

Estimate hat makes shimwellia blattae the ideal candidate host for insecticide? Insects will require to be infected with this bacterium to deliver the insecticide.

  Which organelle compares to which part of your analogy

Make sure you include a labeled picture of what you are comparing your cell to (even though my picture is not labeled. This is NOT a picture of a cell, but of a soccer field or Pizza hut, or a car etc.)

  What combination therapies can be beneficial

Present the comparison of clinical benefit of the use of drugs for Parkinson's Disease. What combination therapies can be beneficial - present the most current strategies for the treatment of Alzheimer's Disease.

  What has been the average annual rate of po

A mutant prostist is found in which some mitochondria lack an inner mitochondrial membrane. Which pathways would be completely disrupted in these mitochondria.

  Why are frameshift mutations insertions and deletions more

1. the following series of nucleotide bases forms part of a dna molecule tacttatgacacaggaggacta convert this string of

  Evaluate the functions of the ventricles of the brain

Evaluate the functions of the ventricles of the brain and the choroid plexus, including their role in the formation and maintenance of CSF

  Visualizing dna for emsa

You are investigating YFP, a transcription factor that binds directly to DNA. You know that it recognizes the sequences.

  Determine the genotypes of the parents

Black coat color in Cocker Spaniels is governed by a dominant allele and red coat by a recessive allele; solid pattern is governed by the dominant allele of another gene and spotted pattern is recessive.

  Or is it more likely that an operon complex could be

operons can be activated by low levels of oxygen... glucose adp and atp and in sustained strenuous physical activity.

  Studying dogs as a model system for obesity

Suppose you are interested in studying dogs as a system for obesity. You crossed a Cocker Spaniel to a Labrador Retriever and interbred the offspring for many generations.

  What is the difference between getting energy

1. What is the difference between getting energy from cellular respiration and getting energy from a log by burning it? 2. Why does the body need to utilize both aerobic and anaerobic respiration?

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd