What is the total magnification of an image

Assignment Help Science
Reference no: EM131080926

1. Using the figure below, which of the cells is gram positive and which is gram negative?  How do you know?

324_figure.png

2. Using the figure above, what other phenotypes can you use to characterize the sample on the right?  

3. You have used a compound microscope to observe your cells.  What is the total magnification of an image if it was viewed using a 10X ocular lens and a 40X objective lens?

4. Next week, you will extract DNA from your chosen microbe.  Read the protocol carefully.  Step 12 instructs you to add isopropanol, and then centrifuge.  After centrifuging the tube, where is the DNA  in the supernatant or in the pellet)?  Why?  

5. Once you have purified your DNA, you will perform PCR.  Answer each of the following questions:

a. You will be amplifying the 16S rDNA locus.  What are two features of this locus that make it valuable for identifying an uncultureable microbe? 

b. If your DNA is at a concentration of 48 ng/ul and you wish to add 100ng of template to your PCR reaction, how many microliters of DNA will you add? 

c. If your initial sample contains 3 copies of the 16S rDNA region, how many copies will there be after 30 PCR cycles? 

6. On day 3, you will perform an agarose gel.  You will load a portion of your PCR reaction on the gel. 

a. How many bands do you expect to see per lane? 

b. What size do you expect the band s) will be? 

7. On Day 4, you will obtain your sequence. An old technology would run chain-terminated products on a polyacrylamide gel to identify the fragments.  On the figure below, draw the gel that would result from the following template sequence make sure to pay attention to the 5' and 3' ends.  Remember how DNA synthesis works!):

3' - ATGGCTGAGGTCTGAAATGTC - 5'

1452_Figure1.png

Reference no: EM131080926

Survey and the other research proposal

Hi, This subject has two assessments , one literature survey and the other research proposal. I have already submitted the literature survey and he gave 17 out of 35. This r

Formulate a speech for two topic for total around 6 minutes.

formulate a speech for two topic for total around 6 minutes. One is topic is how Ocean Acidification affects the US. The other is how Ozone depletion affects the US. Now and f

Sensorimotor integration is fundamental

Sensorimotor integration is fundamental to school success and learning. Think about the importance of sensorimotor integration to teaching, learning, and memory. Justify why y

Identifying fad diets and other weight-loss scams

Describe the path food follows as it travels through the digestive system. Summarize the major structures and functions of those structures along the way.Discuss the causes an

Thucydides versus plato

Write a paper on Thucydides versus Plato on the nature of the Good Life. Some have claimed that Thucydides is making empirical claims, whereas Plato is making normative claims

Do you believe that voter id law are meant to disenfranchise

Do you believe that voter ID laws are meant to disenfranchise voters who are disproportionately members of minority groups or the poor? Do you believe they are discriminator

At what point does a disease become an epidemic, endemic

Explain the impact of at least one major historical contribution on the current status of epidemiological practices. How can history potentially shape and impact our future

Describe object-oriented databases within an ehr system

Describe object-oriented databases within an EHR system.To further support the acquisition of a new electronic health record (EHR) system, the chief information officer (CIO)

Reviews

Write a Review

 
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd