Use electronic marketing resources-company-s stockholders

Assignment Help Basic Computer Science
Reference no: EM1370955

You are the marketing director of a bicycle manufacturing company in a startup situation. Your marketing goals for this initial period are to promote the desired company image, facilitate communication with consumers, and keep track of products, customers, and services. Your company can only afford to use three electronic marketing resources to accomplish these goals. Choose three (3) electronic marketing resources to use and justify each resource in a memo to your company's stockholders.

Your memo will be graded on the following scale:

Memo Format, Introduction, and Closing
1st Marketing Resource Discussed
2nd Marketing Resource Discussed
3rd Marketing Resource Discussed

Reference no: EM1370955

Questions Cloud

Explain what communication devices were used : Explain What communication devices were used by both parties in this example and How did these devices work or not work in this particular intercultural communication example?
Determine overall effect on minimum balance : Assume your bank increase its minimum-balance requirement for free checking on checking accounts by $500. You take $500 out of your passbook savings account
Illustrate what is relation in marginal benefit and cost : Illustrate what level of control variable are net benefits maximized. Illustrate what is relation between marginal benefit and marginal cost at this level of control variable.
Compute maximum displacement of the particle : Soft drinks are commonly sold in aluminium containers. How a lot of such containers are thrown away or recycled each year by U.S. consumers.
Use electronic marketing resources-company-s stockholders : Your company can only afford to utilize three electronic marketing resources to accomplish these goals. Select three electronic marketing resources to use and justify each resource in memo to company's stockholders.
Calculate the distance it travels throughout the second : A car travelling 80 km/h slows down at a constant 0.50 m/s^2 just by "letting up on the gas." Compute the distance the car coasts before it stops in meters.
Provide optimal wage-bonus package : Provide optimal wage-bonus package, compute this employees' effort, expected payoff and employer's profit. Draw a game tree for employer-employee game in parts a-c.
Find out the magnitude of the electrical field : A long straight metal wire of radius r1= 3.30E-2 m is bounded by a metalic cylindrical shell of inner radius r2= 1.39 E-1 m and outer radius r3= 1.84E-1 m.
Explain use the theory of motivation to explain the problem : Explain Use the theory of motivation to explain the problem and Use the theory of motivation to describe an intervention/action to change the motivation/behavior.

Reviews

Write a Review

Basic Computer Science Questions & Answers

  Determine the date in opening of letter

If /home/jenny/draft and /home/alex/letter are links to same file and following sequence of events occurs, what will be date in opening of letter? Alex gives command vim letter.

  How much memory is required to store picture

A 1024*768 image is displayed, noninterlaced, at a rate of thirty frames per second. If the image is stored with 64k-color resolution, which uses 2 bytes per pixel, how much memory is required to store the picture?

  Make report to print gross earnings and tax payable

Your report is to print the gross earnings, tax payable, medical levy and net earnings for each employee. At the end of the report, print the total gross earnings, total tax, total medical levy and total net earnings.

  Perform a web search on it outsourcing and their result

Perform a web search on IT outsourcing and review the results. Select any two IT outsourcing companies and analyze their services, clients, and capabilities.

  Strategic advantages voip brings to businesses

Write down some of the strategic advantages the VoIP brings to businesses that adopt it? Prior, voice and data networks were separate and typically maintained by separate groups.

  Fully web-based access for both general public and secretary

Fully web-based access for both general public and Secretary of state employees a database of drivers and their personnel information contained on their drivers licenses

  Identify position-indicate what pattern is found in thread

Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

  Explain what office automation software works

Create a 2 or more page memorandum explaining what office automation software and group collaboration software are used by people in the organization to accomplish work.

  Cryptography for standardized regulated and mandated

Whose interests are most significant when finding extent to which cryptography must be standardized, regulated, and mandated?

  Input devices

Compare how the gestures data is generated and represented for interpretation in each of the following input devices. In your comparison, consider the data formats (radio waves, electrical signal, sound, etc.), device drivers, operating systems suppo..

  What is the response time for jobs in observed system

We observe a closed system for 30 minutes, during which 1600 tasks are completed, from 12 terminals. Each terminal (source of tasks). What is the response time for jobs in the observed system?

  Expalining independent of choice of a dbms

Which of the following is independent of the choice of a DBMS?

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd