Provide a proof or a counterexample

Assignment Help Basic Computer Science
Reference no: EM13208873

We showed that since the problem concerning a machine halting on its own index is unsolvable, the general halting problem for Turing machines is unsolvable. Does this imply that any superset of an unsolvable problem is unsolvable? Provide a proof or a counterexample.

Reference no: EM13208873

Questions Cloud

Why is the optimal bundle usually a corner solution : What does it mean for two goods to be "perfect substitutes" for each other for a consumer Why is the optimal bundle usually a corner solution when a consumer is choosing a bundle of perfect substitutes
Write a program that prompts the user for an integer value : write a program that prompts the user for an integer value for a length of a youtube clip in seconds then display the number of hours , minutes and seconds within the given length.
Do the utility function exhibit diminishing marginal utility : Do these utility functions exhibit diminishing marginal utility of X Explain. For each utility function, calculate the marginal rate of substitution of good X for good Y (i.e. -marginal value of X, measured in units of good Y) associated with the bun..
How many different types of sundaes can be ordered : If a sundae is allowed to have three scoops of ice cream where each scoop must be a different flavor (order of scoops doesn't matter), and either a syrup or a topping (but not both) are required, how many different types of sundaes can be ordered?
Provide a proof or a counterexample : We showed that since the problem concerning a machine halting on its own index is unsolvable, the general halting problem for Turing machines is unsolvable. Does this imply that any superset of an unsolvable problem is unsolvable? Provide a proof ..
Write a program that prompts the user for an integer value : write a program that prompts the user for an integer value for a length of a youtube clip in seconds then display the number of hours
What is the best affordable bundle for jane : Jane receives utility from days spent traveling domestically (d) and days spend traveling in foreign countries (f). Her utility function is U(d, f) = 10df. She has $4000 per year to spend on travel. It costs $100 to spend a day traveling domestical..
Create a fraction struct that has a numerator : Create a fraction struct that has a numerator and a denominator. Make an overloaded operator + for the struct that can add two fractions and return a fraction result. Make a overloaded
What benefits does voip provide the corporate user : What benefits does VOIP provide the corporate user? What are some considerations when implementing VOIP?

Reviews

Write a Review

 

Basic Computer Science Questions & Answers

  Decision to utilize components influence requirements

Must RMO consider using purchased components in the new CSS? If so, When, must it begin looking for components? How will decision to utilize components influence requirements, design and implementation phases?

  Find out product stream temperature and volume

Find out the product stream temperature and volume required to carry out reaction in a CSTR at 50 % conversion in adiabatic mode of operation.

  Analyze the use of gestures in ipads

Analyze the use of gestures in iPads. Address how users feel about gestures and evaluate how users feel about the user input when it comes to filling out complicated forms on the iPad and assess the usability of back buttons and thumbnails on the iPa..

  The ieee 754 single precision binary representation

What would be the IEEE 754 single precision binary representation of the floating point value -314159265. 3589 ? Express your final answer as an 8-hex-digit number and explain how your answer was obtained for full credit.

  Calculate the expected value for lottery game

Calculate the expected value for this game. Interpret what it means. Do not forget that you initially lose $1 by buying a ticket.

  Financial impact of change on wvu students

Currently, PRT riders who are not WVU students or employees must pay $0.50 per trip. Assume that this charge was eliminated.

  Give a polynomial time reduction

Give a polynomial time reduction from the 3-Color (coloring a graph so that no vertices adjacent to each other have the same color using 3 colors) problem to 3-CNF SAT.

  Identify position-indicate what pattern is found in thread

Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

  Question in unix os

What if we need the portion from a text based on some keyword. Now i want the middle portion where i found EO427849242. I tried with sed but it does not give me the desired result.

  Find the sum of the elements of an array called list1

Write a program to find the sum of the elements of an array called list1. The size of list1 is four bytes. The values of list1 are $FF, $1, $FE, and $02. To check your work, the sum should become $0200.

  Sequence diagram for field officer

Draw a sequence diagram for the following use case. Draw only the first five messages sent. The FieldOfficer activates the "Report Emergency" function of her terminal. The system responds by presenting a form to the officer.

  Report steps necessary evidence and protect company

Jonathan Simpson owns a construction company. Write a one-page report detailing the steps Jonathan and you need to take to obtain the necessary evidence and protect the company.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd