Genetic code tablerelating to amino acids to mRNA codons

Reference no: EM13534592

Using the base pairing of rna to dna, the genetic code tablerelating to amino acids to mRNA codons, and the one letterabbreviations for the amino acids, decode the following geneticmessage? m RNA is to be transcribed from the entire underlinedsequence.Remember that mRNA usesU in place of T and proeinsynthesisbegins with AUG.

CTGACGTATGGCTAACTATTGTCATATATTGGACCGGGAGAACCGTGCGACCGAAATGGCGACCCATGTGGAACGGTATTGGGAATATTGTAATAGCGTGTA
GACTGCATACCGATTGATAACAGTATATAACCTGGCCCTCTTGGCACGCTGGCTTTACCGCTGGGTACACCTTGCCATAACCCTTAATAACATTATCGCACAT-
mRNA?
protein?
The message??

Reference no: EM13534592

Questions Cloud

Immune system as a whole to respondto invading pathogens : How do specificregions of the body inform the immune system as a whole to respondto invading pathogens?

Example of a feedback mechanism : A feedback mechanism (or loop) occurs when one change causes another, which in turn affects the original change. In terms of water, explain how the opening of stomate is an example of a feedback mechanism.

Eukaryotes can generateseveral proteins : Eukaryotes can generateseveral proteins from one gene that contains introns and exons. Identify whichprocesses are involved to produce the mature RNAs.

Role in regulation of gene expression inprokaryotes : The following play(s) a role in regulation of gene expression inprokaryotes

Genetic code tablerelating to amino acids to mRNA codons : Using the base pairing of rna to dna, the genetic code tablerelating to amino acids to mRNA codons, and the one letterabbreviations for the amino acids, decode the following geneticmessage?

Contains the four postulates of natural selection : Which of these lists contains the four postulates of natural selection?

Nutrientcycling is generally quite conservative : In contrast to ecosystems that are not harvested (e.g., native forest, grasslands), where in nutrientcycling is generally quite conservative, most agriculturalecosystems are net exporters of nutrients inherent in soil. Consider the following barle..

Dna replication take palce in the cell cycle : In an insect's life history, the juvenile undergoes a process of physical change called? When does DNA replication take palce in the cell cycle

Many antibiotics operate by interfering with the ribosome : Many antibiotics operate by interfering with the ribosome. Tetracyclin, for example, acts by binding to the 30S subunit. How come we do not die when we take antibiotics if they interfere with protein production?

User Account

All Pages